Incidental Mutation 'R4648:Atp5pf'
ID 350529
Institutional Source Beutler Lab
Gene Symbol Atp5pf
Ensembl Gene ENSMUSG00000022890
Gene Name ATP synthase peripheral stalk subunit F6
Synonyms Atp5j
MMRRC Submission 041909-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.336) question?
Stock # R4648 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 84624754-84632495 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 84625343 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 87 (M87V)
Ref Sequence ENSEMBL: ENSMUSP00000122527 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023608] [ENSMUST00000114191] [ENSMUST00000114193] [ENSMUST00000114195] [ENSMUST00000138279]
AlphaFold P97450
Predicted Effect probably benign
Transcript: ENSMUST00000023608
AA Change: M87V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000023608
Gene: ENSMUSG00000022890
AA Change: M87V

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114191
AA Change: M87V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109829
Gene: ENSMUSG00000022890
AA Change: M87V

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 5.6e-49 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114193
AA Change: M87V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000109831
Gene: ENSMUSG00000022890
AA Change: M87V

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 97 2.7e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114195
SMART Domains Protein: ENSMUSP00000109833
Gene: ENSMUSG00000053062

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IG 36 132 7.7e-5 SMART
IGc2 147 221 1.06e-11 SMART
low complexity region 240 253 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127651
Predicted Effect probably benign
Transcript: ENSMUST00000138279
AA Change: M87V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000122527
Gene: ENSMUSG00000022890
AA Change: M87V

DomainStartEndE-ValueType
Pfam:ATP-synt_F6 1 92 4.5e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140036
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155956
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a component of mitochondrial adenosine triphosphate synthase, which catalyzes the conversion of ATP from ADP. Mitochondrial adenosine triphosphate synthase consists of extrinsic and intrinsic membrane domains that are joined by a stalk. The protein encoded by this gene is a subunit of the stalk domain. A bi-directional promoter that drives expression of this gene has been has been identified. Pseudogenes of this gene are found on chromosomes 14 and 17. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700031F05Rik G T X: 101,904,515 (GRCm39) N132K possibly damaging Het
2010315B03Rik T A 9: 124,056,228 (GRCm39) Y232F probably benign Het
2310079G19Rik T C 16: 88,424,255 (GRCm39) S79G probably benign Het
4930568D16Rik T A 2: 35,244,458 (GRCm39) Y298F probably damaging Het
Alpk2 A G 18: 65,482,953 (GRCm39) F352L probably damaging Het
Angpt1 T A 15: 42,539,580 (GRCm39) Y93F probably benign Het
Ankrd33b T C 15: 31,325,170 (GRCm39) *129W probably null Het
Atp8b3 A G 10: 80,361,457 (GRCm39) S822P possibly damaging Het
Bbs10 A G 10: 111,136,995 (GRCm39) K703E probably benign Het
Bbs2 A T 8: 94,807,507 (GRCm39) V429E probably damaging Het
Bccip C T 7: 133,316,628 (GRCm39) L83F probably damaging Het
Brd9 G A 13: 74,088,895 (GRCm39) V198I probably benign Het
C1galt1c1 A T X: 37,720,349 (GRCm39) S216T probably benign Het
Calhm1 A G 19: 47,132,240 (GRCm39) L125P probably damaging Het
Ccdc110 A T 8: 46,395,705 (GRCm39) Q532L possibly damaging Het
Cdh19 G A 1: 110,852,907 (GRCm39) L343F probably benign Het
Cep350 A G 1: 155,778,344 (GRCm39) S1653P possibly damaging Het
Cmtm4 A G 8: 105,082,952 (GRCm39) I135T possibly damaging Het
Cmya5 A G 13: 93,230,336 (GRCm39) L1584P possibly damaging Het
Crocc2 G A 1: 93,096,516 (GRCm39) V24M possibly damaging Het
Crp A G 1: 172,525,704 (GRCm39) M1V probably null Het
Csmd1 G A 8: 16,048,788 (GRCm39) Q2305* probably null Het
Cyp2c38 T A 19: 39,449,132 (GRCm39) I74F probably benign Het
Dab1 C T 4: 104,588,948 (GRCm39) A524V probably benign Het
Dcaf1 A T 9: 106,742,876 (GRCm39) probably benign Het
Dhx16 C G 17: 36,196,527 (GRCm39) A565G probably benign Het
Dock7 C A 4: 98,857,881 (GRCm39) E1448* probably null Het
Dpf2 C T 19: 5,957,109 (GRCm39) R38H probably damaging Het
E030030I06Rik T A 10: 22,024,744 (GRCm39) R56S unknown Het
Etnk1 A G 6: 143,141,000 (GRCm39) Y248C probably damaging Het
Ext1 A G 15: 52,953,383 (GRCm39) S494P possibly damaging Het
Gk2 T C 5: 97,603,579 (GRCm39) S420G probably benign Het
Gm26596 T C 10: 112,765,064 (GRCm39) probably benign Het
Gm5414 G T 15: 101,536,543 (GRCm39) N27K possibly damaging Het
Gskip A G 12: 105,664,988 (GRCm39) D9G probably benign Het
H2-K2 T A 17: 34,194,989 (GRCm39) noncoding transcript Het
Hk1 T G 10: 62,140,558 (GRCm39) S105R probably benign Het
Hmg20b T A 10: 81,184,416 (GRCm39) Q129L probably damaging Het
Idnk A G 13: 58,310,683 (GRCm39) D67G probably benign Het
Igfbp5 G T 1: 72,903,222 (GRCm39) H118N probably benign Het
Irf4 A T 13: 30,947,580 (GRCm39) Y427F probably benign Het
Khdc3 A G 9: 73,009,868 (GRCm39) E26G possibly damaging Het
Kif7 T C 7: 79,358,939 (GRCm39) D512G probably damaging Het
Lamb3 T A 1: 193,013,665 (GRCm39) I513N probably damaging Het
Lipo3 A G 19: 33,760,860 (GRCm39) L174P probably damaging Het
Lnx1 C T 5: 74,771,457 (GRCm39) V350I probably benign Het
Map3k21 A G 8: 126,668,850 (GRCm39) D812G probably benign Het
Mast2 G T 4: 116,172,036 (GRCm39) Y637* probably null Het
Matn2 T C 15: 34,428,679 (GRCm39) I681T probably damaging Het
Med18 A T 4: 132,190,274 (GRCm39) V37D possibly damaging Het
Mip T A 10: 128,062,922 (GRCm39) H122Q probably benign Het
Mmp13 A T 9: 7,274,233 (GRCm39) D180V probably damaging Het
Mpg C A 11: 32,180,034 (GRCm39) C187* probably null Het
Mtmr14 A G 6: 113,237,567 (GRCm39) E256G probably benign Het
Myo7b C T 18: 32,100,178 (GRCm39) probably null Het
Nhsl3 G T 4: 129,115,733 (GRCm39) T977K probably benign Het
Nmt1 T A 11: 102,954,743 (GRCm39) V425D probably damaging Het
Nynrin T A 14: 56,110,351 (GRCm39) Y1819* probably null Het
Or10ak16 A G 4: 118,751,147 (GRCm39) N289S possibly damaging Het
Or4c107 T A 2: 88,789,556 (GRCm39) F249I probably damaging Het
Or5i1 T C 2: 87,613,565 (GRCm39) V227A possibly damaging Het
Otof T C 5: 30,540,914 (GRCm39) E875G possibly damaging Het
Paqr3 T A 5: 97,256,069 (GRCm39) R102* probably null Het
Phc1 T C 6: 122,298,872 (GRCm39) I699V possibly damaging Het
Prkdc T G 16: 15,634,638 (GRCm39) D3594E probably benign Het
Pstpip1 A T 9: 56,032,502 (GRCm39) D246V probably damaging Het
Rbm46 A T 3: 82,771,765 (GRCm39) D283E probably benign Het
Ror2 A T 13: 53,439,536 (GRCm39) C9* probably null Het
Setd1b C T 5: 123,286,175 (GRCm39) A407V unknown Het
Slc26a4 T G 12: 31,590,525 (GRCm39) D376A possibly damaging Het
Smarcad1 A G 6: 65,044,073 (GRCm39) E215G probably benign Het
Spag16 G A 1: 69,866,194 (GRCm39) R11Q probably null Het
Sult1d1 T A 5: 87,713,954 (GRCm39) Q30L probably benign Het
Tbc1d5 A G 17: 51,043,251 (GRCm39) C746R probably benign Het
Tdh A G 14: 63,731,205 (GRCm39) L323P possibly damaging Het
Tet2 A T 3: 133,193,843 (GRCm39) M197K probably benign Het
Tnn T C 1: 159,973,612 (GRCm39) M252V probably benign Het
Trdn G T 10: 33,071,977 (GRCm39) E215* probably null Het
Trem1 G A 17: 48,551,590 (GRCm39) V84I probably benign Het
Tspan5 T C 3: 138,604,076 (GRCm39) F154L probably damaging Het
Usp45 A G 4: 21,825,044 (GRCm39) R647G probably benign Het
Usp50 T A 2: 126,619,953 (GRCm39) I120F probably damaging Het
Vil1 T C 1: 74,471,457 (GRCm39) M746T probably benign Het
Washc4 T A 10: 83,410,407 (GRCm39) M665K possibly damaging Het
Zfp750 T C 11: 121,402,706 (GRCm39) T681A probably benign Het
Other mutations in Atp5pf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01367:Atp5pf APN 16 84,625,360 (GRCm39) missense probably benign 0.04
IGL02465:Atp5pf APN 16 84,625,358 (GRCm39) missense probably damaging 0.99
R4509:Atp5pf UTSW 16 84,624,862 (GRCm39) missense probably benign 0.01
R4510:Atp5pf UTSW 16 84,624,862 (GRCm39) missense probably benign 0.01
R4511:Atp5pf UTSW 16 84,624,862 (GRCm39) missense probably benign 0.01
R4845:Atp5pf UTSW 16 84,628,365 (GRCm39) missense possibly damaging 0.56
R5973:Atp5pf UTSW 16 84,625,328 (GRCm39) splice site probably null
R7449:Atp5pf UTSW 16 84,628,251 (GRCm39) missense probably benign 0.09
R8285:Atp5pf UTSW 16 84,625,390 (GRCm39) missense probably damaging 0.99
R9537:Atp5pf UTSW 16 84,625,358 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGAACCTCACATGCAATTGTC -3'
(R):5'- GTACCTCCTCTCAGAAACCCTG -3'

Sequencing Primer
(F):5'- GAACCTCACATGCAATTGTCATTAAC -3'
(R):5'- CCTGTGTACCTTATTAAGACTTGATG -3'
Posted On 2015-10-08