Incidental Mutation 'R4649:Adcy10'
ID 350549
Institutional Source Beutler Lab
Gene Symbol Adcy10
Ensembl Gene ENSMUSG00000026567
Gene Name adenylate cyclase 10
Synonyms soluble adenylyl cyclase, Sacy, 4930431D04Rik, sAC
MMRRC Submission 041910-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.255) question?
Stock # R4649 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 165312752-165404343 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 165331618 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 84 (E84K)
Ref Sequence ENSEMBL: ENSMUSP00000137744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027852] [ENSMUST00000111439] [ENSMUST00000111440] [ENSMUST00000148550] [ENSMUST00000155216]
AlphaFold Q8C0T9
Predicted Effect probably damaging
Transcript: ENSMUST00000027852
AA Change: E84K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000027852
Gene: ENSMUSG00000026567
AA Change: E84K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 442 2.3e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 6e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111439
AA Change: E84K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107066
Gene: ENSMUSG00000026567
AA Change: E84K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000111440
AA Change: E84K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107067
Gene: ENSMUSG00000026567
AA Change: E84K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 286 420 1.9e-12 PFAM
low complexity region 838 847 N/A INTRINSIC
low complexity region 899 922 N/A INTRINSIC
low complexity region 1149 1164 N/A INTRINSIC
Blast:TPR 1295 1328 6e-9 BLAST
Blast:TPR 1510 1543 7e-12 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000148550
AA Change: E84K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000137959
Gene: ENSMUSG00000026567
AA Change: E84K

DomainStartEndE-ValueType
CYCc 7 206 3.27e-3 SMART
Pfam:Guanylate_cyc 285 420 4.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000155216
AA Change: E84K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000137744
Gene: ENSMUSG00000026567
AA Change: E84K

DomainStartEndE-ValueType
PDB:4OZ3|A 1 98 2e-51 PDB
Blast:CYCc 7 98 2e-61 BLAST
SCOP:d1azsb_ 43 98 9e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000193149
AA Change: E36K
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a distinct class of adenylyl cyclases that is soluble and insensitive to G protein or forskolin regulation. Activity of this protein is regulated by bicarbonate. Variation at this gene has been observed in patients with absorptive hypercalciuria. Alternatively spliced transcript variants encoding different isoforms have been observed. There is a pseudogene of this gene on chromosome 6. [provided by RefSeq, Jul 2014]
PHENOTYPE: Homozygous null male mutants are infertile with a severe sperm motility defect, female null mutants are fertile. Females exhibit increased cholesterol and triglyceride levels while both sexes have a slight increase in heart rate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,211,320 (GRCm39) E685* probably null Het
2700049A03Rik A T 12: 71,211,321 (GRCm39) E685V possibly damaging Het
4933409G03Rik G A 2: 68,436,559 (GRCm39) E168K unknown Het
Abca4 G T 3: 121,963,542 (GRCm39) V841F probably damaging Het
Adgrg6 C A 10: 14,344,571 (GRCm39) M127I probably damaging Het
Agpat5 A G 8: 18,929,668 (GRCm39) I266V possibly damaging Het
Agtpbp1 A T 13: 59,676,213 (GRCm39) Y186N possibly damaging Het
Alx1 A T 10: 102,845,193 (GRCm39) N279K probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Arsi A G 18: 61,050,170 (GRCm39) Y351C probably damaging Het
B4galnt3 T A 6: 120,201,581 (GRCm39) R155W probably damaging Het
BC028528 T C 3: 95,795,577 (GRCm39) E75G probably damaging Het
Bmp2k C T 5: 97,200,970 (GRCm39) P297S possibly damaging Het
Btnl4 A G 17: 34,691,602 (GRCm39) S296P probably benign Het
Bzw2 A T 12: 36,173,980 (GRCm39) V98E probably null Het
Cacna1d C T 14: 29,817,365 (GRCm39) M1232I probably benign Het
Cast A G 13: 74,894,133 (GRCm39) S171P probably benign Het
Catsperb G A 12: 101,507,771 (GRCm39) A513T probably benign Het
Cd19 A G 7: 126,013,664 (GRCm39) S42P probably benign Het
Chml A G 1: 175,514,962 (GRCm39) S138P probably benign Het
Clic6 T G 16: 92,327,827 (GRCm39) probably null Het
Col12a1 A T 9: 79,547,076 (GRCm39) V2252E probably damaging Het
Cplx2 G A 13: 54,527,361 (GRCm39) E82K probably benign Het
Csmd2 G A 4: 128,439,866 (GRCm39) V3107M probably benign Het
Cspg4 T A 9: 56,794,149 (GRCm39) V628D possibly damaging Het
Dcaf13 G A 15: 39,001,637 (GRCm39) R315Q possibly damaging Het
Deaf1 A G 7: 140,877,486 (GRCm39) V547A possibly damaging Het
Dmxl1 C T 18: 50,011,698 (GRCm39) T1285I probably damaging Het
Dnah3 C A 7: 119,646,921 (GRCm39) W1036L probably damaging Het
Dnai3 A G 3: 145,753,922 (GRCm39) S713P probably damaging Het
Dpy19l1 A C 9: 24,393,350 (GRCm39) S140A possibly damaging Het
Dsg2 T A 18: 20,735,302 (GRCm39) D1093E possibly damaging Het
Edaradd T A 13: 12,523,304 (GRCm39) H12L probably damaging Het
Enam T C 5: 88,640,827 (GRCm39) M163T probably benign Het
Fbxo22 T A 9: 55,128,333 (GRCm39) V218E probably damaging Het
Fbxo34 A T 14: 47,767,085 (GRCm39) K148N probably damaging Het
Foxi3 A G 6: 70,933,960 (GRCm39) D149G probably damaging Het
Gbp8 C T 5: 105,189,807 (GRCm39) G75D probably damaging Het
Gm10784 C T 13: 50,099,251 (GRCm39) noncoding transcript Het
Gm7247 G A 14: 51,807,051 (GRCm39) probably null Het
Grik3 T A 4: 125,544,278 (GRCm39) V333E probably damaging Het
Gsap A T 5: 21,431,309 (GRCm39) D211V probably damaging Het
H2-T15 T C 17: 36,368,768 (GRCm39) Y104C possibly damaging Het
Ino80 T C 2: 119,261,489 (GRCm39) N725S probably damaging Het
Itgad A G 7: 127,788,703 (GRCm39) I443V probably benign Het
Itsn1 T A 16: 91,638,476 (GRCm39) I52N probably damaging Het
Kmt2b TCTCCTCCTCCTCCTCCTCCTCCTCC TCTCCTCCTCCTCCTCCTCCTCC 7: 30,285,783 (GRCm39) probably benign Het
Lamc1 T G 1: 153,104,523 (GRCm39) S59R probably damaging Het
Lrrk1 T C 7: 65,922,801 (GRCm39) I1366V probably benign Het
Lyn C A 4: 3,738,850 (GRCm39) Q41K probably benign Het
Mapk13 C T 17: 28,997,461 (GRCm39) R360* probably null Het
Mapk8ip3 T A 17: 25,123,726 (GRCm39) I599F probably damaging Het
Me1 T C 9: 86,561,905 (GRCm39) K60R probably benign Het
Mga T A 2: 119,771,974 (GRCm39) D1532E possibly damaging Het
Miga1 G A 3: 151,984,642 (GRCm39) S427L probably benign Het
Mknk2 A T 10: 80,505,173 (GRCm39) V186E probably damaging Het
Myo1a C A 10: 127,546,086 (GRCm39) N236K probably benign Het
Myt1 A G 2: 181,439,207 (GRCm39) D243G probably benign Het
Ncf4 T C 15: 78,140,189 (GRCm39) V196A possibly damaging Het
Nlrp5 G T 7: 23,117,603 (GRCm39) L442F probably damaging Het
Olfm4 G A 14: 80,258,747 (GRCm39) D332N probably benign Het
Or4a81 C A 2: 89,619,637 (GRCm39) V20F probably benign Het
Or4b1d T A 2: 89,969,432 (GRCm39) D17V probably damaging Het
Osbpl11 T A 16: 33,016,452 (GRCm39) M69K probably benign Het
Oxnad1 T A 14: 31,824,366 (GRCm39) *312K probably null Het
Plekhg1 A G 10: 3,906,985 (GRCm39) Q634R probably benign Het
Plekhh2 T C 17: 84,882,691 (GRCm39) Y733H probably damaging Het
Ppp1r21 A G 17: 88,856,941 (GRCm39) H132R probably benign Het
Prkcq T C 2: 11,284,333 (GRCm39) V501A possibly damaging Het
Prpf38b G A 3: 108,811,408 (GRCm39) probably benign Het
Prpf4b A T 13: 35,083,954 (GRCm39) M908L probably benign Het
Prps2 T C X: 166,135,288 (GRCm39) D183G probably damaging Het
Pudp T C 18: 50,701,259 (GRCm39) D158G probably damaging Het
R3hdm1 T C 1: 128,112,181 (GRCm39) S422P probably damaging Het
Ranbp3 T A 17: 57,003,640 (GRCm39) probably null Het
Ranbp6 A G 19: 29,787,721 (GRCm39) V877A probably benign Het
Rgsl1 A T 1: 153,693,328 (GRCm39) S618T probably benign Het
Rhox2a A T X: 36,509,015 (GRCm39) I61L probably benign Het
Rhox2a G C X: 36,508,962 (GRCm39) R43P probably benign Het
Rnf207 A C 4: 152,396,612 (GRCm39) D466E probably benign Het
Rnf7 A G 9: 96,353,883 (GRCm39) I80T probably benign Het
Ros1 T A 10: 52,005,764 (GRCm39) I878F possibly damaging Het
Rsbn1 T A 3: 103,861,096 (GRCm39) probably null Het
Sbk1 T C 7: 125,890,301 (GRCm39) S105P probably damaging Het
Sdk1 T C 5: 141,992,380 (GRCm39) Y790H probably damaging Het
Sec62 T A 3: 30,864,683 (GRCm39) N182K unknown Het
Slc15a1 T C 14: 121,715,504 (GRCm39) Y345C probably damaging Het
Slc27a1 G A 8: 72,023,408 (GRCm39) A15T probably benign Het
Slc35d1 A G 4: 103,070,426 (GRCm39) F110L probably damaging Het
Slc39a5 T A 10: 128,233,136 (GRCm39) S333C probably benign Het
Tarbp1 A G 8: 127,173,934 (GRCm39) S927P probably damaging Het
Tns1 A G 1: 73,992,930 (GRCm39) S583P probably damaging Het
Trim38 A T 13: 23,966,952 (GRCm39) D133V probably damaging Het
Trim40 T C 17: 37,193,531 (GRCm39) probably null Het
Trim42 C A 9: 97,244,998 (GRCm39) V601L probably benign Het
Trpc7 G A 13: 57,035,367 (GRCm39) R189C probably damaging Het
Ttc29 A T 8: 79,060,208 (GRCm39) Y376F probably benign Het
Vmn2r63 A G 7: 42,553,114 (GRCm39) I714T possibly damaging Het
Vmn2r68 C A 7: 84,870,743 (GRCm39) A847S probably benign Het
Zbp1 G A 2: 173,049,608 (GRCm39) P385S possibly damaging Het
Zfat A G 15: 68,056,325 (GRCm39) Y237H probably damaging Het
Zfp236 A T 18: 82,615,784 (GRCm39) W1840R probably damaging Het
Zfp426 G T 9: 20,381,923 (GRCm39) Q341K possibly damaging Het
Zfp462 T A 4: 55,009,349 (GRCm39) N438K probably benign Het
Zfp952 T A 17: 33,221,899 (GRCm39) V88E probably damaging Het
Znfx1 G T 2: 166,898,276 (GRCm39) A216D probably benign Het
Other mutations in Adcy10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Adcy10 APN 1 165,379,483 (GRCm39) missense probably benign 0.45
IGL00731:Adcy10 APN 1 165,400,183 (GRCm39) missense probably benign
IGL01099:Adcy10 APN 1 165,367,411 (GRCm39) missense probably benign 0.21
IGL01464:Adcy10 APN 1 165,374,156 (GRCm39) missense probably damaging 1.00
IGL01729:Adcy10 APN 1 165,340,737 (GRCm39) critical splice donor site probably null
IGL02002:Adcy10 APN 1 165,349,412 (GRCm39) missense probably damaging 1.00
IGL02094:Adcy10 APN 1 165,398,189 (GRCm39) missense probably damaging 1.00
IGL02132:Adcy10 APN 1 165,400,112 (GRCm39) missense probably damaging 0.96
IGL02276:Adcy10 APN 1 165,386,697 (GRCm39) missense probably damaging 0.96
IGL02408:Adcy10 APN 1 165,365,949 (GRCm39) missense probably damaging 1.00
IGL02410:Adcy10 APN 1 165,337,977 (GRCm39) missense probably damaging 1.00
IGL02445:Adcy10 APN 1 165,398,313 (GRCm39) missense possibly damaging 0.85
IGL02470:Adcy10 APN 1 165,395,295 (GRCm39) missense probably damaging 1.00
IGL02551:Adcy10 APN 1 165,370,802 (GRCm39) missense probably damaging 1.00
IGL02606:Adcy10 APN 1 165,347,087 (GRCm39) missense possibly damaging 0.88
IGL02609:Adcy10 APN 1 165,366,044 (GRCm39) nonsense probably null
Bugged UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
debye UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
malaysian UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
singaporean UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
PIT4514001:Adcy10 UTSW 1 165,384,360 (GRCm39) missense probably benign 0.28
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0046:Adcy10 UTSW 1 165,367,403 (GRCm39) missense probably damaging 0.99
R0276:Adcy10 UTSW 1 165,400,160 (GRCm39) missense possibly damaging 0.88
R0324:Adcy10 UTSW 1 165,391,818 (GRCm39) missense probably benign 0.00
R0433:Adcy10 UTSW 1 165,379,591 (GRCm39) missense probably damaging 1.00
R0454:Adcy10 UTSW 1 165,398,297 (GRCm39) missense probably damaging 1.00
R0501:Adcy10 UTSW 1 165,337,959 (GRCm39) missense probably damaging 1.00
R0513:Adcy10 UTSW 1 165,347,088 (GRCm39) missense probably benign 0.04
R0533:Adcy10 UTSW 1 165,391,592 (GRCm39) missense probably benign 0.05
R0550:Adcy10 UTSW 1 165,392,884 (GRCm39) missense probably benign 0.00
R0554:Adcy10 UTSW 1 165,340,699 (GRCm39) missense probably benign
R0597:Adcy10 UTSW 1 165,352,631 (GRCm39) critical splice donor site probably null
R0629:Adcy10 UTSW 1 165,370,674 (GRCm39) missense probably damaging 1.00
R1421:Adcy10 UTSW 1 165,391,516 (GRCm39) missense probably damaging 0.98
R1454:Adcy10 UTSW 1 165,342,949 (GRCm39) missense possibly damaging 0.66
R1524:Adcy10 UTSW 1 165,345,972 (GRCm39) missense probably damaging 1.00
R1534:Adcy10 UTSW 1 165,345,881 (GRCm39) missense probably damaging 0.98
R1594:Adcy10 UTSW 1 165,352,602 (GRCm39) missense probably benign 0.02
R1690:Adcy10 UTSW 1 165,347,494 (GRCm39) missense probably damaging 1.00
R1842:Adcy10 UTSW 1 165,330,812 (GRCm39) missense probably damaging 1.00
R1859:Adcy10 UTSW 1 165,349,530 (GRCm39) missense probably damaging 1.00
R1885:Adcy10 UTSW 1 165,398,377 (GRCm39) missense probably benign 0.02
R1929:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2005:Adcy10 UTSW 1 165,352,591 (GRCm39) missense probably benign 0.02
R2211:Adcy10 UTSW 1 165,345,781 (GRCm39) missense probably damaging 1.00
R2225:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2227:Adcy10 UTSW 1 165,345,829 (GRCm39) missense probably damaging 1.00
R2272:Adcy10 UTSW 1 165,337,866 (GRCm39) missense probably damaging 1.00
R2421:Adcy10 UTSW 1 165,386,166 (GRCm39) missense probably damaging 0.97
R3614:Adcy10 UTSW 1 165,403,296 (GRCm39) missense probably benign 0.38
R4538:Adcy10 UTSW 1 165,340,696 (GRCm39) missense probably benign 0.38
R4644:Adcy10 UTSW 1 165,378,930 (GRCm39) critical splice donor site probably null
R4832:Adcy10 UTSW 1 165,334,213 (GRCm39) missense probably damaging 1.00
R4853:Adcy10 UTSW 1 165,375,782 (GRCm39) missense probably benign
R4916:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R4951:Adcy10 UTSW 1 165,391,532 (GRCm39) missense probably damaging 1.00
R4972:Adcy10 UTSW 1 165,384,431 (GRCm39) missense probably damaging 1.00
R5116:Adcy10 UTSW 1 165,347,069 (GRCm39) missense probably damaging 1.00
R5377:Adcy10 UTSW 1 165,347,464 (GRCm39) missense probably damaging 1.00
R5442:Adcy10 UTSW 1 165,340,709 (GRCm39) missense probably benign 0.43
R5692:Adcy10 UTSW 1 165,342,875 (GRCm39) missense probably benign 0.36
R5949:Adcy10 UTSW 1 165,367,386 (GRCm39) missense possibly damaging 0.79
R5998:Adcy10 UTSW 1 165,369,218 (GRCm39) missense probably benign 0.19
R6238:Adcy10 UTSW 1 165,403,297 (GRCm39) nonsense probably null
R6455:Adcy10 UTSW 1 165,345,943 (GRCm39) missense probably damaging 1.00
R6920:Adcy10 UTSW 1 165,403,227 (GRCm39) missense probably damaging 1.00
R6935:Adcy10 UTSW 1 165,334,204 (GRCm39) missense probably benign 0.21
R6957:Adcy10 UTSW 1 165,391,854 (GRCm39) missense probably damaging 1.00
R6970:Adcy10 UTSW 1 165,384,485 (GRCm39) missense probably benign 0.02
R7027:Adcy10 UTSW 1 165,345,815 (GRCm39) missense probably damaging 1.00
R7049:Adcy10 UTSW 1 165,367,443 (GRCm39) missense probably damaging 1.00
R7062:Adcy10 UTSW 1 165,366,091 (GRCm39) missense probably benign 0.27
R7130:Adcy10 UTSW 1 165,331,616 (GRCm39) missense probably damaging 1.00
R7144:Adcy10 UTSW 1 165,337,939 (GRCm39) missense probably benign 0.01
R7182:Adcy10 UTSW 1 165,371,039 (GRCm39) splice site probably null
R7228:Adcy10 UTSW 1 165,337,841 (GRCm39) missense probably damaging 1.00
R7384:Adcy10 UTSW 1 165,404,177 (GRCm39) missense unknown
R7561:Adcy10 UTSW 1 165,386,741 (GRCm39) missense possibly damaging 0.94
R7603:Adcy10 UTSW 1 165,391,806 (GRCm39) missense probably damaging 0.99
R7693:Adcy10 UTSW 1 165,398,340 (GRCm39) missense probably benign 0.01
R7812:Adcy10 UTSW 1 165,342,938 (GRCm39) missense probably damaging 1.00
R7905:Adcy10 UTSW 1 165,340,737 (GRCm39) critical splice donor site probably null
R8040:Adcy10 UTSW 1 165,379,593 (GRCm39) missense probably damaging 1.00
R8242:Adcy10 UTSW 1 165,374,118 (GRCm39) missense possibly damaging 0.82
R8278:Adcy10 UTSW 1 165,330,857 (GRCm39) missense probably damaging 1.00
R8282:Adcy10 UTSW 1 165,337,906 (GRCm39) missense probably benign 0.34
R8812:Adcy10 UTSW 1 165,378,867 (GRCm39) missense probably damaging 0.98
R9039:Adcy10 UTSW 1 165,345,914 (GRCm39) missense probably damaging 1.00
R9178:Adcy10 UTSW 1 165,403,218 (GRCm39) missense possibly damaging 0.79
R9244:Adcy10 UTSW 1 165,370,679 (GRCm39) missense probably benign 0.00
R9712:Adcy10 UTSW 1 165,340,681 (GRCm39) missense probably damaging 1.00
RF018:Adcy10 UTSW 1 165,379,678 (GRCm39) missense probably damaging 1.00
Z1177:Adcy10 UTSW 1 165,337,845 (GRCm39) missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CACTAAGGTCATTTGAAACTCTGCC -3'
(R):5'- TCTAATCAGAAGGAGGCATGTG -3'

Sequencing Primer
(F):5'- GTCATTTGAAACTCTGCCACTTTTAG -3'
(R):5'- CAGAAGGAGGCATGTGTGTGTG -3'
Posted On 2015-10-08