Incidental Mutation 'R0268:Egln2'
ID35066
Institutional Source Beutler Lab
Gene Symbol Egln2
Ensembl Gene ENSMUSG00000058709
Gene Nameegl-9 family hypoxia-inducible factor 2
SynonymsSM-20, Phd1, Ier4, 0610011A13Rik, Hif-p4h-1
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0268 (G1)
Quality Score175
Status Validated
Chromosome7
Chromosomal Location27158658-27166802 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 27165247 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000104019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080058] [ENSMUST00000093040] [ENSMUST00000108382] [ENSMUST00000153511] [ENSMUST00000154724]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080058
AA Change: D84E

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000078966
Gene: ENSMUSG00000058709
AA Change: D84E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000093040
SMART Domains Protein: ENSMUSP00000090727
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
RAB 9 172 2.47e-101 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000108382
AA Change: D84E

PolyPhen 2 Score 0.572 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000104019
Gene: ENSMUSG00000058709
AA Change: D84E

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
low complexity region 64 73 N/A INTRINSIC
Blast:P4Hc 75 136 3e-14 BLAST
low complexity region 154 174 N/A INTRINSIC
P4Hc 201 387 9.71e-44 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152021
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152753
Predicted Effect probably benign
Transcript: ENSMUST00000153511
SMART Domains Protein: ENSMUSP00000138477
Gene: ENSMUSG00000053291

DomainStartEndE-ValueType
Pfam:Arf 3 97 1.8e-11 PFAM
Pfam:Miro 10 95 9.5e-15 PFAM
Pfam:Ras 10 95 7.8e-35 PFAM
Pfam:Gtr1_RagA 10 98 4.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154724
SMART Domains Protein: ENSMUSP00000122859
Gene: ENSMUSG00000095538

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
SH3 46 112 8.92e-5 SMART
Meta Mutation Damage Score 0.0716 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The hypoxia inducible factor (HIF) is a transcriptional complex that is involved in oxygen homeostasis. At normal oxygen levels, the alpha subunit of HIF is targeted for degration by prolyl hydroxylation. This gene encodes an enzyme responsible for this post-translational modification. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the upstream RAB4B (RAB4B, member RAS oncogene family) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygotes are viable with no apparent abnormalities in cardiovascular, hematopoietic, or placental morphology and development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Egln2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01347:Egln2 APN 7 27160292 missense probably null 0.03
IGL01975:Egln2 APN 7 27160320 missense possibly damaging 0.50
IGL02261:Egln2 APN 7 27159866 missense possibly damaging 0.78
R1276:Egln2 UTSW 7 27165005 unclassified probably benign
R1455:Egln2 UTSW 7 27160371 missense probably damaging 1.00
R4569:Egln2 UTSW 7 27159583 missense probably damaging 1.00
R4656:Egln2 UTSW 7 27159193 missense probably benign 0.00
R7201:Egln2 UTSW 7 27160319 missense probably damaging 1.00
R7216:Egln2 UTSW 7 27159829 missense probably damaging 1.00
R7302:Egln2 UTSW 7 27164885 missense probably damaging 0.98
Z1177:Egln2 UTSW 7 27164990 missense not run
Predicted Primers PCR Primer
(F):5'- AGGCACAATATAGTCCAGGGCCAG -3'
(R):5'- ATCAAGCTCTCCCTCAGTTGCCAG -3'

Sequencing Primer
(F):5'- tgttgctgctgctgctg -3'
(R):5'- TCAGAGTCCTTGGAGTCTAGCC -3'
Posted On2013-05-09