Incidental Mutation 'R3983:Speg'
ID 350661
Institutional Source Beutler Lab
Gene Symbol Speg
Ensembl Gene ENSMUSG00000026207
Gene Name SPEG complex locus
Synonyms SPEG, SPEGalpha, SPEGbeta, Apeg1, BPEG, D1Bwg1450e
MMRRC Submission 040944-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3983 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 75351941-75408964 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 75399191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 2213 (P2213T)
Ref Sequence ENSEMBL: ENSMUSP00000084361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087122]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000087122
AA Change: P2213T

PolyPhen 2 Score 0.272 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000084361
Gene: ENSMUSG00000026207
AA Change: P2213T

DomainStartEndE-ValueType
IG 51 128 1.48e-6 SMART
low complexity region 292 318 N/A INTRINSIC
low complexity region 325 338 N/A INTRINSIC
low complexity region 359 368 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
low complexity region 573 584 N/A INTRINSIC
IGc2 739 806 2.19e-9 SMART
Pfam:SPEG_u2 817 873 2.4e-36 PFAM
IGc2 886 954 4.03e-8 SMART
IG 979 1064 1.05e-6 SMART
IGc2 1081 1148 2.19e-9 SMART
IG 1199 1283 6.87e-2 SMART
FN3 1287 1373 1.38e-4 SMART
IG 1401 1487 2.64e-3 SMART
IGc2 1502 1569 1.12e-6 SMART
STYKc 1606 1859 8.44e-63 SMART
Blast:STYKc 1861 1895 6e-12 BLAST
low complexity region 1918 1939 N/A INTRINSIC
low complexity region 2069 2081 N/A INTRINSIC
low complexity region 2208 2227 N/A INTRINSIC
low complexity region 2230 2249 N/A INTRINSIC
low complexity region 2255 2269 N/A INTRINSIC
low complexity region 2343 2366 N/A INTRINSIC
low complexity region 2410 2422 N/A INTRINSIC
low complexity region 2433 2451 N/A INTRINSIC
low complexity region 2457 2487 N/A INTRINSIC
low complexity region 2524 2544 N/A INTRINSIC
IGc2 2599 2667 2.05e-9 SMART
FN3 2681 2760 2.5e-2 SMART
low complexity region 2775 2789 N/A INTRINSIC
low complexity region 2802 2831 N/A INTRINSIC
low complexity region 2912 2927 N/A INTRINSIC
STYKc 2961 3213 4.42e-66 SMART
low complexity region 3241 3250 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000137868
AA Change: P1960T
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143679
Meta Mutation Damage Score 0.1263 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a protein with similarity to members of the myosin light chain kinase family. This protein family is required for myocyte cytoskeletal development. Studies have determined that a lack of this protein affected myocardial development. Multiple alternatively spliced transcript variants that encode different protein isoforms have been defined. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele die during the early postnatal period with enlarged, dilated hearts, and decreased cardiac function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,467,220 (GRCm39) N138Y possibly damaging Het
4921504E06Rik A G 2: 19,547,180 (GRCm39) probably null Het
Abcc6 T C 7: 45,644,713 (GRCm39) I821V probably benign Het
Adam34 G A 8: 44,103,806 (GRCm39) T613I probably benign Het
Ap2b1 C T 11: 83,281,542 (GRCm39) T816M probably damaging Het
Cct2 G A 10: 116,890,040 (GRCm39) P10L probably damaging Het
Cdc23 C A 18: 34,770,539 (GRCm39) probably benign Het
Chrna2 G T 14: 66,386,906 (GRCm39) V351L probably benign Het
Clca3a1 T A 3: 144,461,070 (GRCm39) T194S probably benign Het
Col18a1 C A 10: 76,924,721 (GRCm39) D23Y probably damaging Het
Cyp2c50 A C 19: 40,101,962 (GRCm39) K400T possibly damaging Het
Cyp2c54 G T 19: 40,034,699 (GRCm39) Q324K possibly damaging Het
Dcpp2 T A 17: 24,119,547 (GRCm39) Y120* probably null Het
Ddx11 C T 17: 66,441,125 (GRCm39) R242W probably damaging Het
Dnah7b T A 1: 46,272,871 (GRCm39) V2333E possibly damaging Het
Duxf4 T A 10: 58,071,623 (GRCm39) N197I possibly damaging Het
Eno3 T A 11: 70,552,237 (GRCm39) F296L probably damaging Het
Flnc G A 6: 29,442,940 (GRCm39) V492M probably damaging Het
Gdap1 T G 1: 17,230,131 (GRCm39) probably benign Het
Gm1587 C T 14: 78,032,283 (GRCm39) E118K unknown Het
Gprin3 T C 6: 59,331,545 (GRCm39) E254G possibly damaging Het
Hcrt G A 11: 100,652,679 (GRCm39) R112C probably damaging Het
Hoxa4 A T 6: 52,167,657 (GRCm39) Y175N probably benign Het
Hydin G A 8: 111,118,957 (GRCm39) G504R probably damaging Het
Il1rl1 A G 1: 40,485,823 (GRCm39) R325G possibly damaging Het
Kcp A T 6: 29,484,636 (GRCm39) L1314Q probably damaging Het
Kdm5b C T 1: 134,559,042 (GRCm39) P1522L possibly damaging Het
Kmt2d T G 15: 98,743,927 (GRCm39) probably benign Het
Map3k20 C T 2: 72,268,571 (GRCm39) T526I probably damaging Het
Mfap2 A G 4: 140,741,554 (GRCm39) Q71R possibly damaging Het
Mme T A 3: 63,235,485 (GRCm39) Y178N probably damaging Het
Msr1 A G 8: 40,073,059 (GRCm39) V164A possibly damaging Het
Mybbp1a T C 11: 72,337,996 (GRCm39) V646A probably damaging Het
Mybpc3 A T 2: 90,965,714 (GRCm39) K1175N probably benign Het
Myo1c T A 11: 75,552,325 (GRCm39) L366Q probably benign Het
Or12d15 T C 17: 37,694,289 (GRCm39) V277A possibly damaging Het
Or1e22 A G 11: 73,376,961 (GRCm39) S230P possibly damaging Het
Or6f1 A G 7: 85,970,942 (GRCm39) Y73H probably damaging Het
Palmd T C 3: 116,717,472 (GRCm39) T342A probably benign Het
Pde4d A G 13: 109,876,940 (GRCm39) T29A probably benign Het
Rapgef5 A G 12: 117,692,405 (GRCm39) E563G possibly damaging Het
Rdh19 A G 10: 127,686,017 (GRCm39) N43S probably benign Het
Rnf44 A C 13: 54,830,961 (GRCm39) S98R probably damaging Het
Samhd1 C A 2: 156,965,369 (GRCm39) V149L possibly damaging Het
Scn4a G T 11: 106,238,644 (GRCm39) N214K probably damaging Het
Sh3bp4 A G 1: 89,073,591 (GRCm39) N813S probably benign Het
Sirt3 A T 7: 140,458,025 (GRCm39) C41* probably null Het
Srcin1 T G 11: 97,416,379 (GRCm39) E951A probably damaging Het
Syn2 C G 6: 115,214,259 (GRCm39) T161S probably benign Het
Tbc1d4 T C 14: 101,744,649 (GRCm39) T326A probably benign Het
Tcstv2a G T 13: 120,725,815 (GRCm39) A160S possibly damaging Het
Tes T A 6: 17,099,700 (GRCm39) probably null Het
Thoc2l T C 5: 104,668,889 (GRCm39) V1137A probably benign Het
Tln1 T C 4: 43,553,030 (GRCm39) T354A probably damaging Het
Ttn G T 2: 76,632,705 (GRCm39) S12370R possibly damaging Het
Twsg1 T C 17: 66,236,758 (GRCm39) T91A probably benign Het
Vmn1r181 C T 7: 23,684,234 (GRCm39) T233I probably benign Het
Wee2 A T 6: 40,432,175 (GRCm39) N248I possibly damaging Het
Zfp740 G T 15: 102,116,678 (GRCm39) C56F probably benign Het
Other mutations in Speg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Speg APN 1 75,387,034 (GRCm39) missense possibly damaging 0.95
IGL00979:Speg APN 1 75,387,378 (GRCm39) missense probably damaging 0.98
IGL01122:Speg APN 1 75,386,679 (GRCm39) missense probably damaging 1.00
IGL01293:Speg APN 1 75,364,746 (GRCm39) missense probably damaging 1.00
IGL01304:Speg APN 1 75,404,841 (GRCm39) missense probably benign 0.00
IGL01351:Speg APN 1 75,387,920 (GRCm39) splice site probably benign
IGL01473:Speg APN 1 75,404,929 (GRCm39) missense possibly damaging 0.53
IGL01477:Speg APN 1 75,368,541 (GRCm39) missense probably damaging 1.00
IGL01485:Speg APN 1 75,364,471 (GRCm39) missense probably damaging 1.00
IGL01584:Speg APN 1 75,407,581 (GRCm39) missense probably damaging 1.00
IGL01959:Speg APN 1 75,367,734 (GRCm39) missense probably damaging 1.00
IGL02231:Speg APN 1 75,400,031 (GRCm39) missense probably damaging 1.00
IGL02355:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL02362:Speg APN 1 75,400,559 (GRCm39) missense possibly damaging 0.49
IGL03013:Speg APN 1 75,407,923 (GRCm39) missense probably damaging 0.97
IGL03168:Speg APN 1 75,364,831 (GRCm39) missense probably damaging 1.00
H8562:Speg UTSW 1 75,392,241 (GRCm39) missense probably benign 0.39
R0112:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0311:Speg UTSW 1 75,407,581 (GRCm39) missense probably damaging 1.00
R0315:Speg UTSW 1 75,391,780 (GRCm39) missense possibly damaging 0.88
R0393:Speg UTSW 1 75,400,568 (GRCm39) missense possibly damaging 0.46
R0403:Speg UTSW 1 75,407,428 (GRCm39) splice site probably benign
R0483:Speg UTSW 1 75,361,676 (GRCm39) missense possibly damaging 0.92
R0648:Speg UTSW 1 75,404,622 (GRCm39) missense probably benign
R0683:Speg UTSW 1 75,405,762 (GRCm39) missense probably damaging 1.00
R0800:Speg UTSW 1 75,400,133 (GRCm39) missense probably damaging 1.00
R0815:Speg UTSW 1 75,392,036 (GRCm39) missense probably damaging 1.00
R0835:Speg UTSW 1 75,352,318 (GRCm39) missense probably benign 0.00
R0866:Speg UTSW 1 75,393,727 (GRCm39) missense probably damaging 0.99
R0880:Speg UTSW 1 75,381,705 (GRCm39) missense probably damaging 1.00
R1082:Speg UTSW 1 75,391,782 (GRCm39) missense possibly damaging 0.94
R1140:Speg UTSW 1 75,405,739 (GRCm39) missense probably damaging 1.00
R1252:Speg UTSW 1 75,403,739 (GRCm39) missense probably damaging 1.00
R1301:Speg UTSW 1 75,378,145 (GRCm39) missense probably damaging 1.00
R1348:Speg UTSW 1 75,399,516 (GRCm39) missense probably damaging 0.99
R1388:Speg UTSW 1 75,407,104 (GRCm39) missense probably damaging 0.99
R1465:Speg UTSW 1 75,405,128 (GRCm39) splice site probably benign
R1505:Speg UTSW 1 75,352,186 (GRCm39) missense probably benign 0.02
R1506:Speg UTSW 1 75,394,307 (GRCm39) missense probably benign 0.03
R1531:Speg UTSW 1 75,377,866 (GRCm39) missense possibly damaging 0.86
R1543:Speg UTSW 1 75,398,595 (GRCm39) missense probably damaging 1.00
R1567:Speg UTSW 1 75,404,691 (GRCm39) missense probably benign
R1630:Speg UTSW 1 75,399,621 (GRCm39) missense probably damaging 1.00
R1667:Speg UTSW 1 75,387,193 (GRCm39) splice site probably benign
R1673:Speg UTSW 1 75,387,807 (GRCm39) missense possibly damaging 0.60
R1718:Speg UTSW 1 75,398,388 (GRCm39) missense possibly damaging 0.87
R1718:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1719:Speg UTSW 1 75,394,507 (GRCm39) missense probably benign 0.00
R1759:Speg UTSW 1 75,377,806 (GRCm39) missense possibly damaging 0.95
R1861:Speg UTSW 1 75,365,649 (GRCm39) missense probably damaging 1.00
R1874:Speg UTSW 1 75,400,550 (GRCm39) missense probably benign
R1936:Speg UTSW 1 75,408,052 (GRCm39) missense possibly damaging 0.93
R2192:Speg UTSW 1 75,394,371 (GRCm39) missense probably damaging 1.00
R2204:Speg UTSW 1 75,407,121 (GRCm39) missense probably benign 0.30
R2287:Speg UTSW 1 75,407,109 (GRCm39) missense possibly damaging 0.76
R2696:Speg UTSW 1 75,383,570 (GRCm39) missense probably benign 0.27
R2983:Speg UTSW 1 75,361,574 (GRCm39) missense possibly damaging 0.83
R3110:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3112:Speg UTSW 1 75,399,326 (GRCm39) nonsense probably null
R3154:Speg UTSW 1 75,378,186 (GRCm39) missense probably damaging 1.00
R3720:Speg UTSW 1 75,403,426 (GRCm39) missense probably damaging 1.00
R4133:Speg UTSW 1 75,404,548 (GRCm39) missense probably benign
R4522:Speg UTSW 1 75,404,974 (GRCm39) missense probably damaging 1.00
R4564:Speg UTSW 1 75,368,478 (GRCm39) missense probably damaging 1.00
R4577:Speg UTSW 1 75,392,039 (GRCm39) missense probably damaging 1.00
R4858:Speg UTSW 1 75,398,379 (GRCm39) missense probably damaging 1.00
R4953:Speg UTSW 1 75,400,508 (GRCm39) missense possibly damaging 0.72
R4965:Speg UTSW 1 75,404,347 (GRCm39) missense probably damaging 1.00
R4967:Speg UTSW 1 75,364,513 (GRCm39) missense probably damaging 1.00
R5152:Speg UTSW 1 75,404,742 (GRCm39) missense possibly damaging 0.92
R5156:Speg UTSW 1 75,404,731 (GRCm39) missense probably damaging 0.99
R5371:Speg UTSW 1 75,408,037 (GRCm39) missense possibly damaging 0.50
R5550:Speg UTSW 1 75,405,744 (GRCm39) missense probably damaging 1.00
R5562:Speg UTSW 1 75,403,700 (GRCm39) missense probably damaging 1.00
R5687:Speg UTSW 1 75,395,773 (GRCm39) splice site probably null
R5985:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6004:Speg UTSW 1 75,392,247 (GRCm39) nonsense probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6038:Speg UTSW 1 75,395,103 (GRCm39) critical splice donor site probably null
R6143:Speg UTSW 1 75,391,031 (GRCm39) missense probably damaging 1.00
R6265:Speg UTSW 1 75,383,323 (GRCm39) nonsense probably null
R6347:Speg UTSW 1 75,403,519 (GRCm39) missense probably benign 0.00
R6453:Speg UTSW 1 75,394,616 (GRCm39) missense probably benign 0.06
R6505:Speg UTSW 1 75,406,167 (GRCm39) missense possibly damaging 0.93
R6505:Speg UTSW 1 75,383,328 (GRCm39) missense possibly damaging 0.94
R6531:Speg UTSW 1 75,399,401 (GRCm39) missense probably benign 0.03
R6566:Speg UTSW 1 75,365,107 (GRCm39) missense probably damaging 1.00
R6747:Speg UTSW 1 75,387,039 (GRCm39) critical splice donor site probably null
R6819:Speg UTSW 1 75,368,456 (GRCm39) missense possibly damaging 0.56
R6821:Speg UTSW 1 75,394,547 (GRCm39) missense possibly damaging 0.83
R6919:Speg UTSW 1 75,364,552 (GRCm39) nonsense probably null
R6981:Speg UTSW 1 75,407,557 (GRCm39) missense probably damaging 1.00
R7002:Speg UTSW 1 75,399,912 (GRCm39) missense probably damaging 0.98
R7082:Speg UTSW 1 75,388,091 (GRCm39) missense probably damaging 0.96
R7140:Speg UTSW 1 75,383,414 (GRCm39) critical splice donor site probably null
R7175:Speg UTSW 1 75,399,134 (GRCm39) missense probably benign 0.01
R7178:Speg UTSW 1 75,399,027 (GRCm39) missense possibly damaging 0.46
R7345:Speg UTSW 1 75,361,479 (GRCm39) missense probably damaging 0.97
R7420:Speg UTSW 1 75,407,549 (GRCm39) missense probably damaging 1.00
R7537:Speg UTSW 1 75,378,108 (GRCm39) missense probably damaging 1.00
R7562:Speg UTSW 1 75,407,923 (GRCm39) missense probably damaging 0.97
R7615:Speg UTSW 1 75,405,886 (GRCm39) missense probably damaging 1.00
R7679:Speg UTSW 1 75,382,959 (GRCm39) missense probably damaging 1.00
R7692:Speg UTSW 1 75,377,834 (GRCm39) missense probably benign 0.04
R7696:Speg UTSW 1 75,405,805 (GRCm39) missense probably damaging 1.00
R7719:Speg UTSW 1 75,352,469 (GRCm39) missense probably damaging 1.00
R7794:Speg UTSW 1 75,365,514 (GRCm39) missense probably benign 0.00
R7824:Speg UTSW 1 75,360,661 (GRCm39) splice site probably null
R7834:Speg UTSW 1 75,361,571 (GRCm39) missense probably damaging 1.00
R7892:Speg UTSW 1 75,403,810 (GRCm39) missense probably damaging 1.00
R8015:Speg UTSW 1 75,392,065 (GRCm39) splice site probably benign
R8068:Speg UTSW 1 75,398,894 (GRCm39) missense probably damaging 1.00
R8085:Speg UTSW 1 75,391,997 (GRCm39) missense probably damaging 1.00
R8130:Speg UTSW 1 75,392,240 (GRCm39) missense probably damaging 1.00
R8132:Speg UTSW 1 75,399,639 (GRCm39) missense probably damaging 1.00
R8239:Speg UTSW 1 75,395,677 (GRCm39) missense probably damaging 1.00
R8287:Speg UTSW 1 75,398,880 (GRCm39) missense probably benign 0.26
R8299:Speg UTSW 1 75,364,480 (GRCm39) missense possibly damaging 0.95
R8441:Speg UTSW 1 75,387,976 (GRCm39) missense possibly damaging 0.60
R8468:Speg UTSW 1 75,407,953 (GRCm39) missense probably damaging 1.00
R8555:Speg UTSW 1 75,378,908 (GRCm39) splice site probably null
R8781:Speg UTSW 1 75,383,665 (GRCm39) missense probably damaging 1.00
R8784:Speg UTSW 1 75,381,793 (GRCm39) critical splice donor site probably benign
R8848:Speg UTSW 1 75,404,082 (GRCm39) critical splice donor site probably null
R8881:Speg UTSW 1 75,377,795 (GRCm39) missense possibly damaging 0.67
R8898:Speg UTSW 1 75,365,517 (GRCm39) missense probably damaging 1.00
R8935:Speg UTSW 1 75,399,250 (GRCm39) missense probably benign 0.30
R9019:Speg UTSW 1 75,405,882 (GRCm39) missense probably damaging 1.00
R9027:Speg UTSW 1 75,365,076 (GRCm39) missense possibly damaging 0.67
R9066:Speg UTSW 1 75,361,654 (GRCm39) missense probably damaging 0.99
R9092:Speg UTSW 1 75,399,378 (GRCm39) missense probably benign 0.01
R9117:Speg UTSW 1 75,364,444 (GRCm39) missense probably damaging 1.00
R9202:Speg UTSW 1 75,367,637 (GRCm39) missense probably damaging 1.00
R9246:Speg UTSW 1 75,361,498 (GRCm39) missense probably damaging 1.00
R9248:Speg UTSW 1 75,398,420 (GRCm39) missense probably damaging 1.00
R9451:Speg UTSW 1 75,394,377 (GRCm39) missense probably damaging 1.00
R9452:Speg UTSW 1 75,399,152 (GRCm39) missense probably benign
R9475:Speg UTSW 1 75,364,735 (GRCm39) missense probably damaging 1.00
R9476:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9510:Speg UTSW 1 75,377,768 (GRCm39) missense probably damaging 0.99
R9519:Speg UTSW 1 75,392,380 (GRCm39) missense probably damaging 1.00
R9528:Speg UTSW 1 75,364,447 (GRCm39) missense possibly damaging 0.78
R9542:Speg UTSW 1 75,399,426 (GRCm39) missense probably benign 0.08
R9553:Speg UTSW 1 75,394,645 (GRCm39) missense probably benign 0.00
R9767:Speg UTSW 1 75,403,825 (GRCm39) missense possibly damaging 0.78
R9768:Speg UTSW 1 75,395,617 (GRCm39) nonsense probably null
R9800:Speg UTSW 1 75,399,358 (GRCm39) missense probably benign 0.03
X0025:Speg UTSW 1 75,399,101 (GRCm39) missense probably damaging 1.00
X0026:Speg UTSW 1 75,400,119 (GRCm39) missense possibly damaging 0.88
Z1176:Speg UTSW 1 75,383,238 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,404,327 (GRCm39) missense probably damaging 1.00
Z1177:Speg UTSW 1 75,407,099 (GRCm39) missense probably damaging 0.99
Z1177:Speg UTSW 1 75,405,025 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATCCCCGTGGCCAGACTT -3'
(R):5'- GATTCAAGGTTTTCGATGCTGCC -3'

Sequencing Primer
(F):5'- AGACTTGGGGCTCGCAG -3'
(R):5'- ACGCGCTTCTCAGAGACTC -3'
Posted On 2015-10-08