Mutagenetix > Incidental Mutation

Incidental Mutation 'R3983:Kdm5b'

350663

Institutional Source

Beutler Lab

Gene Symbol

Kdm5b

Ensembl Gene

ENSMUSG00000042207

Gene Name

lysine (K)-specific demethylase 5B

Synonyms

Jarid1b, Plu1, Rb-Bp2, 2210016I17Rik, 2010009J12Rik, PLU-1, D1Ertd202e

MMRRC Submission

040944-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R3983 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

134560171-134635285 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 134631304 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 1522 (P1522L)

Ref Sequence

ENSEMBL: ENSMUSP00000038138 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047714] [ENSMUST00000112198]

AlphaFold

Q80Y84

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047714
AA Change: P1522L

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000038138
Gene: ENSMUSG00000042207
AA Change: P1522L

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	744	2.2e-17	PFAM
Pfam:PLU-1	757	1088	5.6e-92	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC
PHD	1486	1536	1.18e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112198

SMART Domains

Protein: ENSMUSP00000107817
Gene: ENSMUSG00000042207

Domain	Start	End	E-Value	Type
low complexity region	7	30	N/A	INTRINSIC
JmjN	31	72	2.87e-20	SMART
ARID	94	183	7.39e-32	SMART
BRIGHT	98	188	1.51e-35	SMART
low complexity region	228	239	N/A	INTRINSIC
PHD	311	357	6.15e-14	SMART
JmjC	453	619	2.33e-67	SMART
Pfam:zf-C5HC2	692	745	6.7e-21	PFAM
Pfam:PLU-1	756	1088	6e-94	PFAM
low complexity region	1097	1109	N/A	INTRINSIC
PHD	1178	1222	6.2e-10	SMART
low complexity region	1225	1236	N/A	INTRINSIC
low complexity region	1406	1417	N/A	INTRINSIC
low complexity region	1470	1484	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191572

Meta Mutation Damage Score

0.1429

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: This gene encodes a lysine-specific histone demethylase that belongs to the jumonji/ARID domain-containing family of histone demethylases. The encoded protein is capable of demethylating tri-, di- and monomethylated lysine 4 of histone H3. This protein plays a role in the transcriptional repression or certain tumor suppressor genes and is upregulated in certain cancer cells. This protein may also play a role in genome stability and DNA repair. Homozygous mutant mice display decreased body weight, decreased female fertility, lower uterine weight, and a delay in mammary development. Knockout of this gene has also been associated with embryonic lethality. [provided by RefSeq, Dec 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body weight, background-sensitive premature mortality, decreased female fertility, delayed mammary gland development, decreased serum estradiol levels, and reduced mammary epithelial cell proliferation in early puberty. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,517,220	N138Y	possibly damaging	Het
4921504E06Rik	A	G	2: 19,542,369		probably null	Het
Abcc6	T	C	7: 45,995,289	I821V	probably benign	Het
Adam34	G	A	8: 43,650,769	T613I	probably benign	Het
AF067061	G	T	13: 120,264,279	A160S	possibly damaging	Het
Ap2b1	C	T	11: 83,390,716	T816M	probably damaging	Het
BC005561	T	C	5: 104,521,023	V1137A	probably benign	Het
Cct2	G	A	10: 117,054,135	P10L	probably damaging	Het
Cdc23	C	A	18: 34,637,486		probably benign	Het
Chrna2	G	T	14: 66,149,457	V351L	probably benign	Het
Clca3a1	T	A	3: 144,755,309	T194S	probably benign	Het
Col18a1	C	A	10: 77,088,887	D23Y	probably damaging	Het
Cyp2c50	A	C	19: 40,113,518	K400T	possibly damaging	Het
Cyp2c54	G	T	19: 40,046,255	Q324K	possibly damaging	Het
Dcpp2	T	A	17: 23,900,573	Y120*	probably null	Het
Ddx11	C	T	17: 66,134,130	R242W	probably damaging	Het
Dnah7b	T	A	1: 46,233,711	V2333E	possibly damaging	Het
Eno3	T	A	11: 70,661,411	F296L	probably damaging	Het
Flnc	G	A	6: 29,442,941	V492M	probably damaging	Het
Gdap1	T	G	1: 17,159,907		probably benign	Het
Gm1587	C	T	14: 77,794,843	E118K	unknown	Het
Gm4981	T	A	10: 58,235,801	N197I	possibly damaging	Het
Gprin3	T	C	6: 59,354,560	E254G	possibly damaging	Het
Hcrt	G	A	11: 100,761,853	R112C	probably damaging	Het
Hoxa4	A	T	6: 52,190,677	Y175N	probably benign	Het
Hydin	G	A	8: 110,392,325	G504R	probably damaging	Het
Il1rl1	A	G	1: 40,446,663	R325G	possibly damaging	Het
Kcp	A	T	6: 29,484,637	L1314Q	probably damaging	Het
Kmt2d	T	G	15: 98,846,046		probably benign	Het
Map3k20	C	T	2: 72,438,227	T526I	probably damaging	Het
Mfap2	A	G	4: 141,014,243	Q71R	possibly damaging	Het
Mme	T	A	3: 63,328,064	Y178N	probably damaging	Het
Msr1	A	G	8: 39,620,018	V164A	possibly damaging	Het
Mybbp1a	T	C	11: 72,447,170	V646A	probably damaging	Het
Mybpc3	A	T	2: 91,135,369	K1175N	probably benign	Het
Myo1c	T	A	11: 75,661,499	L366Q	probably benign	Het
Olfr105-ps	T	C	17: 37,383,398	V277A	possibly damaging	Het
Olfr308	A	G	7: 86,321,734	Y73H	probably damaging	Het
Olfr381	A	G	11: 73,486,135	S230P	possibly damaging	Het
Palmd	T	C	3: 116,923,823	T342A	probably benign	Het
Pde4d	A	G	13: 109,740,406	T29A	probably benign	Het
Rapgef5	A	G	12: 117,728,670	E563G	possibly damaging	Het
Rdh19	A	G	10: 127,850,148	N43S	probably benign	Het
Rnf44	A	C	13: 54,683,148	S98R	probably damaging	Het
Samhd1	C	A	2: 157,123,449	V149L	possibly damaging	Het
Scn4a	G	T	11: 106,347,818	N214K	probably damaging	Het
Sh3bp4	A	G	1: 89,145,869	N813S	probably benign	Het
Sirt3	A	T	7: 140,878,112	C41*	probably null	Het
Speg	C	A	1: 75,422,547	P2213T	probably benign	Het
Srcin1	T	G	11: 97,525,553	E951A	probably damaging	Het
Syn2	C	G	6: 115,237,298	T161S	probably benign	Het
Tbc1d4	T	C	14: 101,507,213	T326A	probably benign	Het
Tes	T	A	6: 17,099,701		probably null	Het
Tln1	T	C	4: 43,553,030	T354A	probably damaging	Het
Ttn	G	T	2: 76,802,361	S12370R	possibly damaging	Het
Twsg1	T	C	17: 65,929,763	T91A	probably benign	Het
Vmn1r181	C	T	7: 23,984,809	T233I	probably benign	Het
Wee2	A	T	6: 40,455,241	N248I	possibly damaging	Het
Zfp740	G	T	15: 102,208,243	C56F	probably benign	Het

Other mutations in Kdm5b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Kdm5b	APN	1	134620955	missense	probably damaging	1.00
IGL01458:Kdm5b	APN	1	134621986	missense	possibly damaging	0.53
IGL01567:Kdm5b	APN	1	134602540	missense	probably damaging	1.00
IGL01625:Kdm5b	APN	1	134617968	missense	possibly damaging	0.74
IGL01970:Kdm5b	APN	1	134600727	missense	probably damaging	1.00
IGL02183:Kdm5b	APN	1	134624931	missense	probably benign	0.09
IGL02592:Kdm5b	APN	1	134624853	missense	probably damaging	0.99
IGL02695:Kdm5b	APN	1	134604485	missense	possibly damaging	0.94
IGL02697:Kdm5b	APN	1	134588773	splice site	probably benign
IGL03036:Kdm5b	APN	1	134608937	missense	probably damaging	1.00
IGL03056:Kdm5b	APN	1	134587979	missense	probably damaging	0.99
IGL03206:Kdm5b	APN	1	134627317	missense	probably benign
IGL03342:Kdm5b	APN	1	134602576	missense	probably benign	0.00
IGL03388:Kdm5b	APN	1	134627322	missense	probably benign
amaryllis	UTSW	1	134609061	critical splice donor site	probably null
PIT4486001:Kdm5b	UTSW	1	134628685	missense	probably damaging	1.00
R0233:Kdm5b	UTSW	1	134604634	splice site	probably benign
R0334:Kdm5b	UTSW	1	134604522	missense	probably damaging	0.99
R0504:Kdm5b	UTSW	1	134621023	critical splice donor site	probably null
R0505:Kdm5b	UTSW	1	134602571	missense	probably damaging	0.96
R0521:Kdm5b	UTSW	1	134618033	missense	possibly damaging	0.65
R1004:Kdm5b	UTSW	1	134588904	missense	possibly damaging	0.71
R1087:Kdm5b	UTSW	1	134600637	missense	probably damaging	1.00
R1126:Kdm5b	UTSW	1	134613991	missense	possibly damaging	0.90
R1221:Kdm5b	UTSW	1	134599091	missense	probably damaging	0.98
R1230:Kdm5b	UTSW	1	134613254	missense	probably damaging	1.00
R1345:Kdm5b	UTSW	1	134630550	missense	possibly damaging	0.94
R1482:Kdm5b	UTSW	1	134624897	missense	probably damaging	1.00
R1582:Kdm5b	UTSW	1	134624853	missense	probably damaging	0.99
R1653:Kdm5b	UTSW	1	134602481	missense	probably damaging	1.00
R1693:Kdm5b	UTSW	1	134597576	splice site	probably benign
R1721:Kdm5b	UTSW	1	134613181	splice site	probably benign
R1741:Kdm5b	UTSW	1	134618017	missense	possibly damaging	0.82
R1762:Kdm5b	UTSW	1	134604467	nonsense	probably null
R1820:Kdm5b	UTSW	1	134597670	missense	possibly damaging	0.87
R1872:Kdm5b	UTSW	1	134624994	missense	probably damaging	1.00
R1966:Kdm5b	UTSW	1	134613873	splice site	probably null
R2056:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2059:Kdm5b	UTSW	1	134613214	missense	probably benign	0.05
R2405:Kdm5b	UTSW	1	134609016	missense	probably damaging	0.97
R3417:Kdm5b	UTSW	1	134587977	missense	probably damaging	1.00
R3771:Kdm5b	UTSW	1	134613345	missense	probably damaging	1.00
R3783:Kdm5b	UTSW	1	134630542	missense	probably benign
R3803:Kdm5b	UTSW	1	134615941	missense	probably benign	0.07
R3980:Kdm5b	UTSW	1	134619670	missense	probably benign	0.11
R4013:Kdm5b	UTSW	1	134627329	missense	possibly damaging	0.86
R4162:Kdm5b	UTSW	1	134625161	missense	probably benign	0.01
R4701:Kdm5b	UTSW	1	134606012	intron	probably benign
R4791:Kdm5b	UTSW	1	134630800	missense	possibly damaging	0.82
R4836:Kdm5b	UTSW	1	134593315	splice site	probably null
R4924:Kdm5b	UTSW	1	134631351	missense	probably benign	0.00
R5135:Kdm5b	UTSW	1	134588746	intron	probably benign
R5248:Kdm5b	UTSW	1	134620997	missense	probably benign	0.11
R5290:Kdm5b	UTSW	1	134622099	splice site	probably null
R5358:Kdm5b	UTSW	1	134607694	nonsense	probably null
R5388:Kdm5b	UTSW	1	134608897	nonsense	probably null
R5396:Kdm5b	UTSW	1	134622098	splice site	probably null
R5397:Kdm5b	UTSW	1	134622098	splice site	probably null
R5398:Kdm5b	UTSW	1	134622098	splice site	probably null
R5399:Kdm5b	UTSW	1	134622098	splice site	probably null
R5529:Kdm5b	UTSW	1	134588003	missense	probably damaging	1.00
R5540:Kdm5b	UTSW	1	134631241	missense	probably damaging	0.98
R5661:Kdm5b	UTSW	1	134599073	missense	probably benign	0.01
R5663:Kdm5b	UTSW	1	134630635	missense	probably benign
R5822:Kdm5b	UTSW	1	134588773	splice site	probably benign
R6226:Kdm5b	UTSW	1	134608878	missense	probably damaging	0.99
R6368:Kdm5b	UTSW	1	134599207	missense	probably damaging	1.00
R6681:Kdm5b	UTSW	1	134613269	missense	possibly damaging	0.90
R6715:Kdm5b	UTSW	1	134609061	critical splice donor site	probably null
R7132:Kdm5b	UTSW	1	134599106	missense	probably damaging	1.00
R7202:Kdm5b	UTSW	1	134624759	missense	probably benign
R7258:Kdm5b	UTSW	1	134621021	missense	probably damaging	1.00
R7335:Kdm5b	UTSW	1	134560439	missense	probably damaging	1.00
R7420:Kdm5b	UTSW	1	134604497	missense	probably benign	0.14
R7426:Kdm5b	UTSW	1	134595833	missense	probably benign	0.02
R7452:Kdm5b	UTSW	1	134624948	missense	probably damaging	1.00
R7595:Kdm5b	UTSW	1	134608966	missense	probably benign	0.00
R7612:Kdm5b	UTSW	1	134624918	nonsense	probably null
R7704:Kdm5b	UTSW	1	134587931	missense	probably damaging	1.00
R7846:Kdm5b	UTSW	1	134617840	missense	probably damaging	1.00
R8115:Kdm5b	UTSW	1	134619673	missense	possibly damaging	0.83
R8146:Kdm5b	UTSW	1	134625126	missense	probably benign	0.05
R8160:Kdm5b	UTSW	1	134613919	missense	probably damaging	1.00
R8527:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8542:Kdm5b	UTSW	1	134605774	missense	possibly damaging	0.78
R8930:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8932:Kdm5b	UTSW	1	134616272	missense	probably damaging	1.00
R8950:Kdm5b	UTSW	1	134613926	missense	possibly damaging	0.84
R9089:Kdm5b	UTSW	1	134607768	missense	probably damaging	0.98
R9109:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9133:Kdm5b	UTSW	1	134602585	missense	probably benign
R9298:Kdm5b	UTSW	1	134600755	critical splice donor site	probably null
R9423:Kdm5b	UTSW	1	134587967	missense	possibly damaging	0.85
R9630:Kdm5b	UTSW	1	134585233	critical splice donor site	probably null
R9670:Kdm5b	UTSW	1	134630502	nonsense	probably null
X0063:Kdm5b	UTSW	1	134588876	missense	probably benign	0.07
Z1176:Kdm5b	UTSW	1	134625035	missense	probably damaging	1.00
Z1177:Kdm5b	UTSW	1	134595798	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGAAGAGTGACTCTGCCTC -3'
(R):5'- AAATAGCACCGTGTACAGGC -3'

Sequencing Primer
(F):5'- AGTGACTCTGCCTCCCAGC -3'
(R):5'- TGTACAGGCTGGCTCGAC -3'

Posted On

2015-10-08