Incidental Mutation 'R3983:Clca3a1'
ID 350671
Institutional Source Beutler Lab
Gene Symbol Clca3a1
Ensembl Gene ENSMUSG00000056025
Gene Name chloride channel accessory 3A1
Synonyms Clca1
MMRRC Submission 040944-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.065) question?
Stock # R3983 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 144435438-144466738 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 144461070 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 194 (T194S)
Ref Sequence ENSEMBL: ENSMUSP00000029932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029932] [ENSMUST00000059091]
AlphaFold Q9QX15
Predicted Effect probably benign
Transcript: ENSMUST00000029932
AA Change: T194S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000029932
Gene: ENSMUSG00000056025
AA Change: T194S

DomainStartEndE-ValueType
Pfam:CLCA_N 1 262 5.8e-144 PFAM
VWA 306 473 1.81e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059091
AA Change: T194S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000054526
Gene: ENSMUSG00000056025
AA Change: T194S

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 478 1.44e-23 SMART
Blast:FN3 758 857 2e-44 BLAST
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,467,220 (GRCm39) N138Y possibly damaging Het
4921504E06Rik A G 2: 19,547,180 (GRCm39) probably null Het
Abcc6 T C 7: 45,644,713 (GRCm39) I821V probably benign Het
Adam34 G A 8: 44,103,806 (GRCm39) T613I probably benign Het
Ap2b1 C T 11: 83,281,542 (GRCm39) T816M probably damaging Het
Cct2 G A 10: 116,890,040 (GRCm39) P10L probably damaging Het
Cdc23 C A 18: 34,770,539 (GRCm39) probably benign Het
Chrna2 G T 14: 66,386,906 (GRCm39) V351L probably benign Het
Col18a1 C A 10: 76,924,721 (GRCm39) D23Y probably damaging Het
Cyp2c50 A C 19: 40,101,962 (GRCm39) K400T possibly damaging Het
Cyp2c54 G T 19: 40,034,699 (GRCm39) Q324K possibly damaging Het
Dcpp2 T A 17: 24,119,547 (GRCm39) Y120* probably null Het
Ddx11 C T 17: 66,441,125 (GRCm39) R242W probably damaging Het
Dnah7b T A 1: 46,272,871 (GRCm39) V2333E possibly damaging Het
Duxf4 T A 10: 58,071,623 (GRCm39) N197I possibly damaging Het
Eno3 T A 11: 70,552,237 (GRCm39) F296L probably damaging Het
Flnc G A 6: 29,442,940 (GRCm39) V492M probably damaging Het
Gdap1 T G 1: 17,230,131 (GRCm39) probably benign Het
Gm1587 C T 14: 78,032,283 (GRCm39) E118K unknown Het
Gprin3 T C 6: 59,331,545 (GRCm39) E254G possibly damaging Het
Hcrt G A 11: 100,652,679 (GRCm39) R112C probably damaging Het
Hoxa4 A T 6: 52,167,657 (GRCm39) Y175N probably benign Het
Hydin G A 8: 111,118,957 (GRCm39) G504R probably damaging Het
Il1rl1 A G 1: 40,485,823 (GRCm39) R325G possibly damaging Het
Kcp A T 6: 29,484,636 (GRCm39) L1314Q probably damaging Het
Kdm5b C T 1: 134,559,042 (GRCm39) P1522L possibly damaging Het
Kmt2d T G 15: 98,743,927 (GRCm39) probably benign Het
Map3k20 C T 2: 72,268,571 (GRCm39) T526I probably damaging Het
Mfap2 A G 4: 140,741,554 (GRCm39) Q71R possibly damaging Het
Mme T A 3: 63,235,485 (GRCm39) Y178N probably damaging Het
Msr1 A G 8: 40,073,059 (GRCm39) V164A possibly damaging Het
Mybbp1a T C 11: 72,337,996 (GRCm39) V646A probably damaging Het
Mybpc3 A T 2: 90,965,714 (GRCm39) K1175N probably benign Het
Myo1c T A 11: 75,552,325 (GRCm39) L366Q probably benign Het
Or12d15 T C 17: 37,694,289 (GRCm39) V277A possibly damaging Het
Or1e22 A G 11: 73,376,961 (GRCm39) S230P possibly damaging Het
Or6f1 A G 7: 85,970,942 (GRCm39) Y73H probably damaging Het
Palmd T C 3: 116,717,472 (GRCm39) T342A probably benign Het
Pde4d A G 13: 109,876,940 (GRCm39) T29A probably benign Het
Rapgef5 A G 12: 117,692,405 (GRCm39) E563G possibly damaging Het
Rdh19 A G 10: 127,686,017 (GRCm39) N43S probably benign Het
Rnf44 A C 13: 54,830,961 (GRCm39) S98R probably damaging Het
Samhd1 C A 2: 156,965,369 (GRCm39) V149L possibly damaging Het
Scn4a G T 11: 106,238,644 (GRCm39) N214K probably damaging Het
Sh3bp4 A G 1: 89,073,591 (GRCm39) N813S probably benign Het
Sirt3 A T 7: 140,458,025 (GRCm39) C41* probably null Het
Speg C A 1: 75,399,191 (GRCm39) P2213T probably benign Het
Srcin1 T G 11: 97,416,379 (GRCm39) E951A probably damaging Het
Syn2 C G 6: 115,214,259 (GRCm39) T161S probably benign Het
Tbc1d4 T C 14: 101,744,649 (GRCm39) T326A probably benign Het
Tcstv2a G T 13: 120,725,815 (GRCm39) A160S possibly damaging Het
Tes T A 6: 17,099,700 (GRCm39) probably null Het
Thoc2l T C 5: 104,668,889 (GRCm39) V1137A probably benign Het
Tln1 T C 4: 43,553,030 (GRCm39) T354A probably damaging Het
Ttn G T 2: 76,632,705 (GRCm39) S12370R possibly damaging Het
Twsg1 T C 17: 66,236,758 (GRCm39) T91A probably benign Het
Vmn1r181 C T 7: 23,684,234 (GRCm39) T233I probably benign Het
Wee2 A T 6: 40,432,175 (GRCm39) N248I possibly damaging Het
Zfp740 G T 15: 102,116,678 (GRCm39) C56F probably benign Het
Other mutations in Clca3a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca3a1 APN 3 144,733,660 (GRCm39) missense probably benign 0.01
IGL00768:Clca3a1 APN 3 144,461,012 (GRCm39) missense probably damaging 0.96
IGL00862:Clca3a1 APN 3 144,730,332 (GRCm39) missense possibly damaging 0.89
IGL00895:Clca3a1 APN 3 144,730,357 (GRCm39) missense probably damaging 1.00
IGL00969:Clca3a1 APN 3 144,714,719 (GRCm39) missense possibly damaging 0.80
IGL01331:Clca3a1 APN 3 144,453,273 (GRCm39) missense probably damaging 1.00
IGL01398:Clca3a1 APN 3 144,722,512 (GRCm39) missense possibly damaging 0.81
IGL01447:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01455:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01457:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01458:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01462:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01473:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01488:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01490:Clca3a1 APN 3 144,713,539 (GRCm39) missense probably benign 0.00
IGL01632:Clca3a1 APN 3 144,733,202 (GRCm39) missense probably damaging 1.00
IGL01895:Clca3a1 APN 3 144,453,333 (GRCm39) nonsense probably null
IGL01896:Clca3a1 APN 3 144,721,438 (GRCm39) missense possibly damaging 0.79
IGL01940:Clca3a1 APN 3 144,452,737 (GRCm39) missense probably benign 0.25
IGL02162:Clca3a1 APN 3 144,460,564 (GRCm39) missense probably damaging 0.98
IGL02200:Clca3a1 APN 3 144,457,690 (GRCm39) splice site probably benign
IGL02411:Clca3a1 APN 3 144,733,763 (GRCm39) missense possibly damaging 0.89
IGL03093:Clca3a1 APN 3 144,453,262 (GRCm39) missense probably damaging 0.99
IGL03156:Clca3a1 APN 3 144,719,672 (GRCm39) missense probably damaging 1.00
Lucha UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R0256:Clca3a1 UTSW 3 144,436,640 (GRCm39) missense probably damaging 0.98
R0472:Clca3a1 UTSW 3 144,733,106 (GRCm39) missense probably damaging 1.00
R0513:Clca3a1 UTSW 3 144,466,323 (GRCm39) critical splice donor site probably null
R0543:Clca3a1 UTSW 3 144,454,155 (GRCm39) splice site probably benign
R0571:Clca3a1 UTSW 3 144,713,550 (GRCm39) missense probably damaging 1.00
R0585:Clca3a1 UTSW 3 144,738,386 (GRCm39) missense probably benign 0.16
R0586:Clca3a1 UTSW 3 144,738,350 (GRCm39) missense probably benign 0.45
R0791:Clca3a1 UTSW 3 144,710,615 (GRCm39) missense probably benign 0.01
R1187:Clca3a1 UTSW 3 144,715,504 (GRCm39) missense probably benign 0.30
R1522:Clca3a1 UTSW 3 144,460,932 (GRCm39) missense probably benign 0.01
R1713:Clca3a1 UTSW 3 144,730,307 (GRCm39) missense probably benign 0.00
R1739:Clca3a1 UTSW 3 144,713,539 (GRCm39) missense probably benign 0.00
R1744:Clca3a1 UTSW 3 144,452,596 (GRCm39) missense probably damaging 0.99
R1873:Clca3a1 UTSW 3 144,452,590 (GRCm39) missense probably damaging 0.99
R2079:Clca3a1 UTSW 3 144,713,534 (GRCm39) missense possibly damaging 0.80
R2129:Clca3a1 UTSW 3 144,722,526 (GRCm39) missense probably damaging 1.00
R2178:Clca3a1 UTSW 3 144,711,863 (GRCm39) missense probably damaging 1.00
R2234:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2235:Clca3a1 UTSW 3 144,714,829 (GRCm39) missense possibly damaging 0.93
R2238:Clca3a1 UTSW 3 144,457,766 (GRCm39) missense possibly damaging 0.94
R2240:Clca3a1 UTSW 3 144,714,746 (GRCm39) missense probably damaging 1.00
R2278:Clca3a1 UTSW 3 144,463,785 (GRCm39) missense probably damaging 0.99
R2516:Clca3a1 UTSW 3 144,443,619 (GRCm39) splice site probably null
R3737:Clca3a1 UTSW 3 144,436,482 (GRCm39) missense probably benign 0.01
R3751:Clca3a1 UTSW 3 144,724,424 (GRCm39) missense probably benign 0.01
R3974:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3975:Clca3a1 UTSW 3 144,738,400 (GRCm39) missense probably damaging 1.00
R3981:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R3982:Clca3a1 UTSW 3 144,461,070 (GRCm39) missense probably benign 0.00
R4038:Clca3a1 UTSW 3 144,460,994 (GRCm39) missense probably benign 0.35
R4382:Clca3a1 UTSW 3 144,466,483 (GRCm39) start codon destroyed probably benign 0.08
R4409:Clca3a1 UTSW 3 144,711,788 (GRCm39) missense probably damaging 1.00
R4543:Clca3a1 UTSW 3 144,452,749 (GRCm39) missense probably damaging 1.00
R4586:Clca3a1 UTSW 3 144,722,619 (GRCm39) missense probably damaging 1.00
R4751:Clca3a1 UTSW 3 144,710,609 (GRCm39) missense possibly damaging 0.89
R4766:Clca3a1 UTSW 3 144,455,473 (GRCm39) missense probably damaging 1.00
R4894:Clca3a1 UTSW 3 144,719,662 (GRCm39) missense probably damaging 0.99
R4899:Clca3a1 UTSW 3 144,443,722 (GRCm39) missense probably damaging 1.00
R4909:Clca3a1 UTSW 3 144,730,324 (GRCm39) missense probably damaging 1.00
R4916:Clca3a1 UTSW 3 144,721,605 (GRCm39) missense probably benign 0.01
R4941:Clca3a1 UTSW 3 144,721,414 (GRCm39) missense probably damaging 1.00
R4942:Clca3a1 UTSW 3 144,710,524 (GRCm39) missense probably benign 0.02
R5044:Clca3a1 UTSW 3 144,713,689 (GRCm39) splice site probably null
R5090:Clca3a1 UTSW 3 144,443,633 (GRCm39) missense probably benign 0.01
R5091:Clca3a1 UTSW 3 144,436,483 (GRCm39) missense probably benign 0.00
R5205:Clca3a1 UTSW 3 144,452,545 (GRCm39) missense possibly damaging 0.68
R5248:Clca3a1 UTSW 3 144,442,897 (GRCm39) missense possibly damaging 0.62
R5354:Clca3a1 UTSW 3 144,442,766 (GRCm39) missense possibly damaging 0.77
R5451:Clca3a1 UTSW 3 144,733,747 (GRCm39) missense probably damaging 1.00
R5618:Clca3a1 UTSW 3 144,710,738 (GRCm39) missense probably benign 0.00
R5724:Clca3a1 UTSW 3 144,714,833 (GRCm39) missense probably benign 0.01
R5871:Clca3a1 UTSW 3 144,460,642 (GRCm39) missense probably damaging 1.00
R5898:Clca3a1 UTSW 3 144,722,522 (GRCm39) missense possibly damaging 0.89
R5907:Clca3a1 UTSW 3 144,455,403 (GRCm39) intron probably benign
R5976:Clca3a1 UTSW 3 144,452,636 (GRCm39) missense probably damaging 1.00
R6190:Clca3a1 UTSW 3 144,463,821 (GRCm39) missense probably benign 0.40
R6193:Clca3a1 UTSW 3 144,464,993 (GRCm39) missense possibly damaging 0.65
R6238:Clca3a1 UTSW 3 144,714,716 (GRCm39) missense probably benign 0.09
R6263:Clca3a1 UTSW 3 144,455,539 (GRCm39) missense probably damaging 1.00
R6299:Clca3a1 UTSW 3 144,464,275 (GRCm39) missense probably damaging 0.99
R6327:Clca3a1 UTSW 3 144,436,558 (GRCm39) missense probably benign 0.02
R6497:Clca3a1 UTSW 3 144,465,020 (GRCm39) missense possibly damaging 0.81
R6542:Clca3a1 UTSW 3 144,465,021 (GRCm39) missense probably benign 0.01
R6547:Clca3a1 UTSW 3 144,442,708 (GRCm39) missense probably damaging 1.00
R6590:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6591:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6592:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6690:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6691:Clca3a1 UTSW 3 144,719,644 (GRCm39) missense probably damaging 1.00
R6729:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R6759:Clca3a1 UTSW 3 144,455,450 (GRCm39) missense probably damaging 1.00
R6805:Clca3a1 UTSW 3 144,724,428 (GRCm39) missense probably damaging 1.00
R7032:Clca3a1 UTSW 3 144,453,329 (GRCm39) missense probably benign 0.07
R7063:Clca3a1 UTSW 3 144,460,967 (GRCm39) missense probably damaging 0.97
R7106:Clca3a1 UTSW 3 144,733,190 (GRCm39) missense probably damaging 0.98
R7121:Clca3a1 UTSW 3 144,717,567 (GRCm39) missense probably damaging 1.00
R7127:Clca3a1 UTSW 3 144,711,806 (GRCm39) missense probably damaging 1.00
R7139:Clca3a1 UTSW 3 144,461,063 (GRCm39) missense possibly damaging 0.58
R7212:Clca3a1 UTSW 3 144,711,727 (GRCm39) missense probably damaging 1.00
R7444:Clca3a1 UTSW 3 144,733,193 (GRCm39) missense probably damaging 1.00
R7446:Clca3a1 UTSW 3 144,733,188 (GRCm39) missense possibly damaging 0.65
R7535:Clca3a1 UTSW 3 144,724,328 (GRCm39) missense probably damaging 0.99
R7638:Clca3a1 UTSW 3 144,457,723 (GRCm39) missense probably damaging 1.00
R7663:Clca3a1 UTSW 3 144,442,797 (GRCm39) missense probably benign 0.02
R7792:Clca3a1 UTSW 3 144,455,492 (GRCm39) missense possibly damaging 0.95
R7798:Clca3a1 UTSW 3 144,463,723 (GRCm39) missense probably damaging 1.00
R7892:Clca3a1 UTSW 3 144,436,579 (GRCm39) missense probably benign 0.00
R8096:Clca3a1 UTSW 3 144,455,446 (GRCm39) missense probably damaging 1.00
R8305:Clca3a1 UTSW 3 144,464,927 (GRCm39) splice site probably benign
R8416:Clca3a1 UTSW 3 144,460,914 (GRCm39) critical splice donor site probably null
R8437:Clca3a1 UTSW 3 144,710,822 (GRCm39) missense probably benign 0.00
R8446:Clca3a1 UTSW 3 144,454,248 (GRCm39) missense probably damaging 0.97
R8474:Clca3a1 UTSW 3 144,710,792 (GRCm39) missense possibly damaging 0.77
R8496:Clca3a1 UTSW 3 144,453,182 (GRCm39) makesense probably null
R8766:Clca3a1 UTSW 3 144,714,939 (GRCm39) splice site probably benign
R8884:Clca3a1 UTSW 3 144,719,757 (GRCm39) missense probably benign 0.35
R9014:Clca3a1 UTSW 3 144,442,731 (GRCm39) missense probably benign 0.01
R9049:Clca3a1 UTSW 3 144,733,143 (GRCm39) missense probably benign 0.01
R9128:Clca3a1 UTSW 3 144,463,795 (GRCm39) missense probably damaging 1.00
R9306:Clca3a1 UTSW 3 144,730,339 (GRCm39) missense probably damaging 1.00
R9601:Clca3a1 UTSW 3 144,453,310 (GRCm39) missense probably benign 0.27
R9623:Clca3a1 UTSW 3 144,719,698 (GRCm39) missense probably benign 0.03
X0020:Clca3a1 UTSW 3 144,738,421 (GRCm39) missense possibly damaging 0.89
Z1088:Clca3a1 UTSW 3 144,452,714 (GRCm39) missense probably damaging 1.00
Z1176:Clca3a1 UTSW 3 144,719,682 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACACGCTTGGAGGGTCATC -3'
(R):5'- ATAGCAGTTGCCACAGAGAG -3'

Sequencing Primer
(F):5'- CTTGGAGGGTCATCGAGGAAAG -3'
(R):5'- CAGTTGCCACAGAGAGATTTTAG -3'
Posted On 2015-10-08