Mutagenetix > Incidental Mutation

Incidental Mutation 'R3983:Mfap2'

350673

Institutional Source

Beutler Lab

Gene Symbol

Mfap2

Ensembl Gene

ENSMUSG00000060572

Gene Name

microfibrillar-associated protein 2

Synonyms

Magp

MMRRC Submission

040944-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.146) question?

Stock #

R3983 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

140737735-140743286 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 140741554 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 71 (Q71R)

Ref Sequence

ENSEMBL: ENSMUSP00000132711 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040222] [ENSMUST00000071977] [ENSMUST00000097816] [ENSMUST00000102491] [ENSMUST00000166376] [ENSMUST00000168157]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000040222

SMART Domains

Protein: ENSMUSP00000037679
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071977
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000071868
Gene: ENSMUSG00000060572
AA Change: Q71R

Domain	Start	End	E-Value	Type
Pfam:MAGP	3	153	1.2e-62	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000097816

SMART Domains

Protein: ENSMUSP00000095425
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000102491

SMART Domains

Protein: ENSMUSP00000099549
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
low complexity region	2	15	N/A	INTRINSIC
low complexity region	77	93	N/A	INTRINSIC
Pfam:Rootletin	158	336	9.7e-65	PFAM
low complexity region	354	381	N/A	INTRINSIC
internal_repeat_2	462	479	1.77e-6	PROSPERO
low complexity region	493	514	N/A	INTRINSIC
internal_repeat_3	527	557	8.63e-6	PROSPERO
internal_repeat_6	533	556	4.21e-5	PROSPERO
low complexity region	561	575	N/A	INTRINSIC
low complexity region	576	594	N/A	INTRINSIC
low complexity region	617	638	N/A	INTRINSIC
low complexity region	788	807	N/A	INTRINSIC
low complexity region	863	880	N/A	INTRINSIC
low complexity region	1009	1039	N/A	INTRINSIC
internal_repeat_4	1050	1068	4.21e-5	PROSPERO
internal_repeat_7	1057	1070	9.31e-5	PROSPERO
internal_repeat_2	1057	1074	1.77e-6	PROSPERO
internal_repeat_4	1061	1078	4.21e-5	PROSPERO
internal_repeat_1	1076	1101	3.36e-8	PROSPERO
internal_repeat_7	1192	1205	9.31e-5	PROSPERO
low complexity region	1271	1288	N/A	INTRINSIC
internal_repeat_5	1302	1328	4.21e-5	PROSPERO
low complexity region	1354	1365	N/A	INTRINSIC
low complexity region	1417	1433	N/A	INTRINSIC
low complexity region	1434	1453	N/A	INTRINSIC
low complexity region	1461	1473	N/A	INTRINSIC
internal_repeat_6	1697	1720	4.21e-5	PROSPERO
low complexity region	1723	1740	N/A	INTRINSIC
coiled coil region	1744	1871	N/A	INTRINSIC
coiled coil region	1892	1996	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122846

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124506

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126973

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166376
AA Change: Q71R

PolyPhen 2 Score 0.800 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000132711
Gene: ENSMUSG00000060572
AA Change: Q71R

Domain	Start	End	E-Value	Type
Pfam:MAGP	2	153	2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151455

Predicted Effect

probably benign
Transcript: ENSMUST00000168157

SMART Domains

Protein: ENSMUSP00000126543
Gene: ENSMUSG00000040860

Domain	Start	End	E-Value	Type
Pfam:Rootletin	1	173	6.1e-48	PFAM
low complexity region	190	217	N/A	INTRINSIC
internal_repeat_2	298	315	1.08e-6	PROSPERO
low complexity region	329	350	N/A	INTRINSIC
internal_repeat_3	363	393	5.38e-6	PROSPERO
internal_repeat_6	369	392	2.67e-5	PROSPERO
low complexity region	397	411	N/A	INTRINSIC
low complexity region	412	430	N/A	INTRINSIC
low complexity region	453	474	N/A	INTRINSIC
low complexity region	624	643	N/A	INTRINSIC
low complexity region	699	716	N/A	INTRINSIC
low complexity region	845	875	N/A	INTRINSIC
internal_repeat_4	886	904	2.67e-5	PROSPERO
internal_repeat_7	893	906	5.96e-5	PROSPERO
internal_repeat_2	893	910	1.08e-6	PROSPERO
internal_repeat_4	897	914	2.67e-5	PROSPERO
internal_repeat_1	912	937	1.97e-8	PROSPERO
internal_repeat_7	1028	1041	5.96e-5	PROSPERO
low complexity region	1107	1124	N/A	INTRINSIC
internal_repeat_5	1138	1164	2.67e-5	PROSPERO
low complexity region	1190	1201	N/A	INTRINSIC
low complexity region	1253	1269	N/A	INTRINSIC
low complexity region	1270	1289	N/A	INTRINSIC
low complexity region	1297	1309	N/A	INTRINSIC
internal_repeat_6	1533	1556	2.67e-5	PROSPERO
low complexity region	1559	1576	N/A	INTRINSIC
coiled coil region	1580	1707	N/A	INTRINSIC
coiled coil region	1728	1832	N/A	INTRINSIC

Meta Mutation Damage Score

0.0758

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microfibrillar-associated protein 2 is a major antigen of elastin-associated microfibrils and a candidate for involvement in the etiology of inherited connective tissue diseases. Four transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygotes for a knock-out allele show thrombocytopenia, delayed thrombotic occlusion following vessel injury, and prolonged bleeding from a tail vein incision. Homozygotes for a different knock-out allele exhibit marrow adipose tissue expansion, insulin resistance, and altered basal hematopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,467,220 (GRCm39)	N138Y	possibly damaging	Het
4921504E06Rik	A	G	2: 19,547,180 (GRCm39)		probably null	Het
Abcc6	T	C	7: 45,644,713 (GRCm39)	I821V	probably benign	Het
Adam34	G	A	8: 44,103,806 (GRCm39)	T613I	probably benign	Het
Ap2b1	C	T	11: 83,281,542 (GRCm39)	T816M	probably damaging	Het
Cct2	G	A	10: 116,890,040 (GRCm39)	P10L	probably damaging	Het
Cdc23	C	A	18: 34,770,539 (GRCm39)		probably benign	Het
Chrna2	G	T	14: 66,386,906 (GRCm39)	V351L	probably benign	Het
Clca3a1	T	A	3: 144,461,070 (GRCm39)	T194S	probably benign	Het
Col18a1	C	A	10: 76,924,721 (GRCm39)	D23Y	probably damaging	Het
Cyp2c50	A	C	19: 40,101,962 (GRCm39)	K400T	possibly damaging	Het
Cyp2c54	G	T	19: 40,034,699 (GRCm39)	Q324K	possibly damaging	Het
Dcpp2	T	A	17: 24,119,547 (GRCm39)	Y120*	probably null	Het
Ddx11	C	T	17: 66,441,125 (GRCm39)	R242W	probably damaging	Het
Dnah7b	T	A	1: 46,272,871 (GRCm39)	V2333E	possibly damaging	Het
Duxf4	T	A	10: 58,071,623 (GRCm39)	N197I	possibly damaging	Het
Eno3	T	A	11: 70,552,237 (GRCm39)	F296L	probably damaging	Het
Flnc	G	A	6: 29,442,940 (GRCm39)	V492M	probably damaging	Het
Gdap1	T	G	1: 17,230,131 (GRCm39)		probably benign	Het
Gm1587	C	T	14: 78,032,283 (GRCm39)	E118K	unknown	Het
Gprin3	T	C	6: 59,331,545 (GRCm39)	E254G	possibly damaging	Het
Hcrt	G	A	11: 100,652,679 (GRCm39)	R112C	probably damaging	Het
Hoxa4	A	T	6: 52,167,657 (GRCm39)	Y175N	probably benign	Het
Hydin	G	A	8: 111,118,957 (GRCm39)	G504R	probably damaging	Het
Il1rl1	A	G	1: 40,485,823 (GRCm39)	R325G	possibly damaging	Het
Kcp	A	T	6: 29,484,636 (GRCm39)	L1314Q	probably damaging	Het
Kdm5b	C	T	1: 134,559,042 (GRCm39)	P1522L	possibly damaging	Het
Kmt2d	T	G	15: 98,743,927 (GRCm39)		probably benign	Het
Map3k20	C	T	2: 72,268,571 (GRCm39)	T526I	probably damaging	Het
Mme	T	A	3: 63,235,485 (GRCm39)	Y178N	probably damaging	Het
Msr1	A	G	8: 40,073,059 (GRCm39)	V164A	possibly damaging	Het
Mybbp1a	T	C	11: 72,337,996 (GRCm39)	V646A	probably damaging	Het
Mybpc3	A	T	2: 90,965,714 (GRCm39)	K1175N	probably benign	Het
Myo1c	T	A	11: 75,552,325 (GRCm39)	L366Q	probably benign	Het
Or12d15	T	C	17: 37,694,289 (GRCm39)	V277A	possibly damaging	Het
Or1e22	A	G	11: 73,376,961 (GRCm39)	S230P	possibly damaging	Het
Or6f1	A	G	7: 85,970,942 (GRCm39)	Y73H	probably damaging	Het
Palmd	T	C	3: 116,717,472 (GRCm39)	T342A	probably benign	Het
Pde4d	A	G	13: 109,876,940 (GRCm39)	T29A	probably benign	Het
Rapgef5	A	G	12: 117,692,405 (GRCm39)	E563G	possibly damaging	Het
Rdh19	A	G	10: 127,686,017 (GRCm39)	N43S	probably benign	Het
Rnf44	A	C	13: 54,830,961 (GRCm39)	S98R	probably damaging	Het
Samhd1	C	A	2: 156,965,369 (GRCm39)	V149L	possibly damaging	Het
Scn4a	G	T	11: 106,238,644 (GRCm39)	N214K	probably damaging	Het
Sh3bp4	A	G	1: 89,073,591 (GRCm39)	N813S	probably benign	Het
Sirt3	A	T	7: 140,458,025 (GRCm39)	C41*	probably null	Het
Speg	C	A	1: 75,399,191 (GRCm39)	P2213T	probably benign	Het
Srcin1	T	G	11: 97,416,379 (GRCm39)	E951A	probably damaging	Het
Syn2	C	G	6: 115,214,259 (GRCm39)	T161S	probably benign	Het
Tbc1d4	T	C	14: 101,744,649 (GRCm39)	T326A	probably benign	Het
Tcstv2a	G	T	13: 120,725,815 (GRCm39)	A160S	possibly damaging	Het
Tes	T	A	6: 17,099,700 (GRCm39)		probably null	Het
Thoc2l	T	C	5: 104,668,889 (GRCm39)	V1137A	probably benign	Het
Tln1	T	C	4: 43,553,030 (GRCm39)	T354A	probably damaging	Het
Ttn	G	T	2: 76,632,705 (GRCm39)	S12370R	possibly damaging	Het
Twsg1	T	C	17: 66,236,758 (GRCm39)	T91A	probably benign	Het
Vmn1r181	C	T	7: 23,684,234 (GRCm39)	T233I	probably benign	Het
Wee2	A	T	6: 40,432,175 (GRCm39)	N248I	possibly damaging	Het
Zfp740	G	T	15: 102,116,678 (GRCm39)	C56F	probably benign	Het

Other mutations in Mfap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01318:Mfap2	APN	4	140,742,856 (GRCm39)	missense	possibly damaging	0.82
IGL02422:Mfap2	APN	4	140,741,535 (GRCm39)	missense	probably benign	0.02
R0149:Mfap2	UTSW	4	140,742,294 (GRCm39)	missense	probably damaging	1.00
R0361:Mfap2	UTSW	4	140,742,294 (GRCm39)	missense	probably damaging	1.00
R0545:Mfap2	UTSW	4	140,741,496 (GRCm39)	unclassified	probably benign
R3981:Mfap2	UTSW	4	140,741,554 (GRCm39)	missense	possibly damaging	0.80
R4993:Mfap2	UTSW	4	140,742,889 (GRCm39)	makesense	probably null
R5019:Mfap2	UTSW	4	140,742,569 (GRCm39)	missense	probably damaging	1.00
R8026:Mfap2	UTSW	4	140,741,114 (GRCm39)	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GCAGACTACTATGACTACCAAGG -3'
(R):5'- TCTCCAGCTTACCAAGAGGG -3'

Sequencing Primer
(F):5'- CTATGACTACCAAGGTAAAAGTCTGG -3'
(R):5'- TAGGCTCAGTCTCCAGGTC -3'

Posted On

2015-10-08