Incidental Mutation 'R3983:Gprin3'
ID350681
Institutional Source Beutler Lab
Gene Symbol Gprin3
Ensembl Gene ENSMUSG00000045441
Gene NameGPRIN family member 3
Synonyms
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R3983 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location59347226-59426294 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59354560 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 254 (E254G)
Ref Sequence ENSEMBL: ENSMUSP00000051805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051065]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051065
AA Change: E254G

PolyPhen 2 Score 0.719 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000051805
Gene: ENSMUSG00000045441
AA Change: E254G

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
low complexity region 311 329 N/A INTRINSIC
low complexity region 593 609 N/A INTRINSIC
Pfam:GRIN_C 627 758 2.7e-49 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
4921504E06Rik A G 2: 19,542,369 probably null Het
Abcc6 T C 7: 45,995,289 I821V probably benign Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gdap1 T G 1: 17,159,907 probably benign Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Scn4a G T 11: 106,347,818 N214K probably damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Tln1 T C 4: 43,553,030 T354A probably damaging Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in Gprin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Gprin3 APN 6 59353837 missense possibly damaging 0.72
IGL02059:Gprin3 APN 6 59355325 utr 5 prime probably benign
IGL02080:Gprin3 APN 6 59354191 missense possibly damaging 0.91
IGL02183:Gprin3 APN 6 59353162 missense possibly damaging 0.87
IGL02267:Gprin3 APN 6 59354473 missense probably benign 0.02
IGL02801:Gprin3 APN 6 59354981 missense possibly damaging 0.53
IGL03212:Gprin3 APN 6 59355028 missense probably benign
R0505:Gprin3 UTSW 6 59353387 missense probably damaging 0.98
R0944:Gprin3 UTSW 6 59353915 missense possibly damaging 0.72
R1028:Gprin3 UTSW 6 59354609 missense possibly damaging 0.53
R1180:Gprin3 UTSW 6 59354936 missense possibly damaging 0.86
R1290:Gprin3 UTSW 6 59354464 missense possibly damaging 0.53
R2060:Gprin3 UTSW 6 59354519 missense possibly damaging 0.73
R2403:Gprin3 UTSW 6 59354149 missense probably benign 0.13
R3830:Gprin3 UTSW 6 59353633 missense probably benign 0.12
R3893:Gprin3 UTSW 6 59354479 missense probably benign 0.12
R4812:Gprin3 UTSW 6 59353365 missense possibly damaging 0.85
R4932:Gprin3 UTSW 6 59354173 missense probably benign 0.33
R4944:Gprin3 UTSW 6 59354659 missense probably benign 0.00
R5523:Gprin3 UTSW 6 59353946 nonsense probably null
R5677:Gprin3 UTSW 6 59353892 missense possibly damaging 0.73
R5772:Gprin3 UTSW 6 59354413 missense possibly damaging 0.86
R5879:Gprin3 UTSW 6 59354713 missense probably benign
R5881:Gprin3 UTSW 6 59354786 missense probably benign 0.18
R6044:Gprin3 UTSW 6 59353672 missense possibly damaging 0.72
R6272:Gprin3 UTSW 6 59353331 nonsense probably null
R7140:Gprin3 UTSW 6 59355143 missense possibly damaging 0.85
R7528:Gprin3 UTSW 6 59354032 missense possibly damaging 0.85
R7891:Gprin3 UTSW 6 59353711 missense probably benign 0.22
R7974:Gprin3 UTSW 6 59353711 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGGTAGAGACAGACCTGCTC -3'
(R):5'- AGCCAAGGAATTTTACAGACTCC -3'

Sequencing Primer
(F):5'- CTGTACCTCAGCATCTTGCCAAG -3'
(R):5'- CAGATATAGCATCCCCTTCTGCAG -3'
Posted On2015-10-08