Incidental Mutation 'R3983:Abcc6'
ID 350684
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene Name ATP-binding cassette, sub-family C (CFTR/MRP), member 6
Synonyms Mrp6, DCC, Dyscalc1
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.850) question?
Stock # R3983 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 45967555-46030302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45995289 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 821 (I821V)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
AlphaFold Q9R1S7
Predicted Effect probably benign
Transcript: ENSMUST00000002850
AA Change: I821V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: I821V

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211780
Meta Mutation Damage Score 0.2153 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
4921504E06Rik A G 2: 19,542,369 probably null Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gdap1 T G 1: 17,159,907 probably benign Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Gprin3 T C 6: 59,354,560 E254G possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Scn4a G T 11: 106,347,818 N214K probably damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Tln1 T C 4: 43,553,030 T354A probably damaging Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4208:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
R7896:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R8098:Abcc6 UTSW 7 45996665 missense probably damaging 1.00
R8443:Abcc6 UTSW 7 45980025 missense probably damaging 1.00
R8773:Abcc6 UTSW 7 45985145 missense probably benign
R8784:Abcc6 UTSW 7 46002601 missense probably benign
R8802:Abcc6 UTSW 7 46008859 missense probably damaging 0.99
R8807:Abcc6 UTSW 7 45999007 missense possibly damaging 0.67
R9006:Abcc6 UTSW 7 46016396 missense probably benign 0.00
R9127:Abcc6 UTSW 7 45979760 missense probably damaging 1.00
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Z1176:Abcc6 UTSW 7 45979734 missense probably damaging 1.00
Z1176:Abcc6 UTSW 7 45992306 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAGCCTTCTCCTAAAGGG -3'
(R):5'- AGAAGCTCTCAAAGGTTGGCC -3'

Sequencing Primer
(F):5'- TCCTAAAGGGAGCCAGGCAC -3'
(R):5'- AAGCCCACATCTTCTAAATTTGC -3'
Posted On 2015-10-08