Incidental Mutation 'R3983:Ap2b1'
ID 350700
Institutional Source Beutler Lab
Gene Symbol Ap2b1
Ensembl Gene ENSMUSG00000035152
Gene Name adaptor-related protein complex 2, beta 1 subunit
Synonyms 1300012O03Rik
MMRRC Submission 040944-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R3983 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 83189850-83295861 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 83281542 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 816 (T816M)
Ref Sequence ENSEMBL: ENSMUSP00000135445 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]
AlphaFold Q9DBG3
Predicted Effect probably damaging
Transcript: ENSMUST00000018875
AA Change: T854M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: T854M

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 2.6e-173 PFAM
Pfam:HEAT_2 88 157 3.7e-8 PFAM
Pfam:Cnd1 99 268 2.1e-40 PFAM
Pfam:HEAT_2 124 219 1.4e-9 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 950 9.93e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065692
AA Change: T840M

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: T840M

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4.2e-173 PFAM
Pfam:HEAT_2 88 157 2.7e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Alpha_adaptinC2 707 817 2.94e-18 SMART
B2-adapt-app_C 826 936 9.93e-56 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000176430
AA Change: T854M

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: T854M

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 534 4e-173 PFAM
Pfam:HEAT_2 88 157 2.8e-8 PFAM
Pfam:Cnd1 99 268 1.5e-37 PFAM
low complexity region 625 643 N/A INTRINSIC
low complexity region 654 675 N/A INTRINSIC
Alpha_adaptinC2 721 831 2.94e-18 SMART
B2-adapt-app_C 840 936 7.22e-35 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000176523
AA Change: T816M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: T816M

DomainStartEndE-ValueType
Pfam:Adaptin_N 10 95 1.1e-26 PFAM
Pfam:Cnd1 69 230 1.5e-26 PFAM
Pfam:HEAT_2 85 182 5.1e-9 PFAM
Pfam:Adaptin_N 90 496 4e-125 PFAM
low complexity region 587 605 N/A INTRINSIC
low complexity region 616 637 N/A INTRINSIC
Alpha_adaptinC2 683 793 2.94e-18 SMART
B2-adapt-app_C 802 912 9.93e-56 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,467,220 (GRCm39) N138Y possibly damaging Het
4921504E06Rik A G 2: 19,547,180 (GRCm39) probably null Het
Abcc6 T C 7: 45,644,713 (GRCm39) I821V probably benign Het
Adam34 G A 8: 44,103,806 (GRCm39) T613I probably benign Het
Cct2 G A 10: 116,890,040 (GRCm39) P10L probably damaging Het
Cdc23 C A 18: 34,770,539 (GRCm39) probably benign Het
Chrna2 G T 14: 66,386,906 (GRCm39) V351L probably benign Het
Clca3a1 T A 3: 144,461,070 (GRCm39) T194S probably benign Het
Col18a1 C A 10: 76,924,721 (GRCm39) D23Y probably damaging Het
Cyp2c50 A C 19: 40,101,962 (GRCm39) K400T possibly damaging Het
Cyp2c54 G T 19: 40,034,699 (GRCm39) Q324K possibly damaging Het
Dcpp2 T A 17: 24,119,547 (GRCm39) Y120* probably null Het
Ddx11 C T 17: 66,441,125 (GRCm39) R242W probably damaging Het
Dnah7b T A 1: 46,272,871 (GRCm39) V2333E possibly damaging Het
Duxf4 T A 10: 58,071,623 (GRCm39) N197I possibly damaging Het
Eno3 T A 11: 70,552,237 (GRCm39) F296L probably damaging Het
Flnc G A 6: 29,442,940 (GRCm39) V492M probably damaging Het
Gdap1 T G 1: 17,230,131 (GRCm39) probably benign Het
Gm1587 C T 14: 78,032,283 (GRCm39) E118K unknown Het
Gprin3 T C 6: 59,331,545 (GRCm39) E254G possibly damaging Het
Hcrt G A 11: 100,652,679 (GRCm39) R112C probably damaging Het
Hoxa4 A T 6: 52,167,657 (GRCm39) Y175N probably benign Het
Hydin G A 8: 111,118,957 (GRCm39) G504R probably damaging Het
Il1rl1 A G 1: 40,485,823 (GRCm39) R325G possibly damaging Het
Kcp A T 6: 29,484,636 (GRCm39) L1314Q probably damaging Het
Kdm5b C T 1: 134,559,042 (GRCm39) P1522L possibly damaging Het
Kmt2d T G 15: 98,743,927 (GRCm39) probably benign Het
Map3k20 C T 2: 72,268,571 (GRCm39) T526I probably damaging Het
Mfap2 A G 4: 140,741,554 (GRCm39) Q71R possibly damaging Het
Mme T A 3: 63,235,485 (GRCm39) Y178N probably damaging Het
Msr1 A G 8: 40,073,059 (GRCm39) V164A possibly damaging Het
Mybbp1a T C 11: 72,337,996 (GRCm39) V646A probably damaging Het
Mybpc3 A T 2: 90,965,714 (GRCm39) K1175N probably benign Het
Myo1c T A 11: 75,552,325 (GRCm39) L366Q probably benign Het
Or12d15 T C 17: 37,694,289 (GRCm39) V277A possibly damaging Het
Or1e22 A G 11: 73,376,961 (GRCm39) S230P possibly damaging Het
Or6f1 A G 7: 85,970,942 (GRCm39) Y73H probably damaging Het
Palmd T C 3: 116,717,472 (GRCm39) T342A probably benign Het
Pde4d A G 13: 109,876,940 (GRCm39) T29A probably benign Het
Rapgef5 A G 12: 117,692,405 (GRCm39) E563G possibly damaging Het
Rdh19 A G 10: 127,686,017 (GRCm39) N43S probably benign Het
Rnf44 A C 13: 54,830,961 (GRCm39) S98R probably damaging Het
Samhd1 C A 2: 156,965,369 (GRCm39) V149L possibly damaging Het
Scn4a G T 11: 106,238,644 (GRCm39) N214K probably damaging Het
Sh3bp4 A G 1: 89,073,591 (GRCm39) N813S probably benign Het
Sirt3 A T 7: 140,458,025 (GRCm39) C41* probably null Het
Speg C A 1: 75,399,191 (GRCm39) P2213T probably benign Het
Srcin1 T G 11: 97,416,379 (GRCm39) E951A probably damaging Het
Syn2 C G 6: 115,214,259 (GRCm39) T161S probably benign Het
Tbc1d4 T C 14: 101,744,649 (GRCm39) T326A probably benign Het
Tcstv2a G T 13: 120,725,815 (GRCm39) A160S possibly damaging Het
Tes T A 6: 17,099,700 (GRCm39) probably null Het
Thoc2l T C 5: 104,668,889 (GRCm39) V1137A probably benign Het
Tln1 T C 4: 43,553,030 (GRCm39) T354A probably damaging Het
Ttn G T 2: 76,632,705 (GRCm39) S12370R possibly damaging Het
Twsg1 T C 17: 66,236,758 (GRCm39) T91A probably benign Het
Vmn1r181 C T 7: 23,684,234 (GRCm39) T233I probably benign Het
Wee2 A T 6: 40,432,175 (GRCm39) N248I possibly damaging Het
Zfp740 G T 15: 102,116,678 (GRCm39) C56F probably benign Het
Other mutations in Ap2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Ap2b1 APN 11 83,223,984 (GRCm39) missense probably damaging 0.99
IGL01583:Ap2b1 APN 11 83,215,437 (GRCm39) missense possibly damaging 0.61
IGL01753:Ap2b1 APN 11 83,212,799 (GRCm39) missense probably damaging 1.00
IGL01992:Ap2b1 APN 11 83,226,356 (GRCm39) missense probably damaging 1.00
IGL02192:Ap2b1 APN 11 83,237,592 (GRCm39) missense possibly damaging 0.48
IGL02315:Ap2b1 APN 11 83,227,625 (GRCm39) missense probably damaging 0.96
IGL03235:Ap2b1 APN 11 83,232,210 (GRCm39) missense probably benign 0.41
P0045:Ap2b1 UTSW 11 83,258,852 (GRCm39) missense probably damaging 1.00
R0121:Ap2b1 UTSW 11 83,212,793 (GRCm39) missense possibly damaging 0.66
R0334:Ap2b1 UTSW 11 83,258,700 (GRCm39) splice site probably benign
R1222:Ap2b1 UTSW 11 83,237,564 (GRCm39) missense probably benign 0.06
R1297:Ap2b1 UTSW 11 83,223,935 (GRCm39) missense probably damaging 1.00
R1653:Ap2b1 UTSW 11 83,237,657 (GRCm39) missense probably damaging 1.00
R1719:Ap2b1 UTSW 11 83,215,430 (GRCm39) missense probably damaging 1.00
R1885:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1886:Ap2b1 UTSW 11 83,281,561 (GRCm39) missense probably damaging 0.99
R1965:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R1966:Ap2b1 UTSW 11 83,237,721 (GRCm39) missense probably benign 0.00
R2046:Ap2b1 UTSW 11 83,227,212 (GRCm39) missense probably benign 0.14
R2086:Ap2b1 UTSW 11 83,241,944 (GRCm39) missense possibly damaging 0.88
R2132:Ap2b1 UTSW 11 83,215,587 (GRCm39) splice site probably benign
R3615:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R3616:Ap2b1 UTSW 11 83,215,391 (GRCm39) missense possibly damaging 0.84
R4124:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4125:Ap2b1 UTSW 11 83,256,471 (GRCm39) critical splice acceptor site probably null
R4198:Ap2b1 UTSW 11 83,233,429 (GRCm39) missense probably damaging 1.00
R4202:Ap2b1 UTSW 11 83,226,430 (GRCm39) critical splice donor site probably null
R4543:Ap2b1 UTSW 11 83,215,476 (GRCm39) missense probably damaging 1.00
R4583:Ap2b1 UTSW 11 83,288,605 (GRCm39) missense probably benign 0.00
R4589:Ap2b1 UTSW 11 83,223,837 (GRCm39) nonsense probably null
R4916:Ap2b1 UTSW 11 83,281,532 (GRCm39) missense probably damaging 1.00
R5005:Ap2b1 UTSW 11 83,230,218 (GRCm39) missense probably damaging 1.00
R5385:Ap2b1 UTSW 11 83,233,427 (GRCm39) missense probably damaging 1.00
R5510:Ap2b1 UTSW 11 83,227,563 (GRCm39) splice site probably null
R5738:Ap2b1 UTSW 11 83,227,256 (GRCm39) splice site probably null
R6023:Ap2b1 UTSW 11 83,226,224 (GRCm39) missense probably damaging 0.99
R6269:Ap2b1 UTSW 11 83,237,499 (GRCm39) missense probably damaging 1.00
R6383:Ap2b1 UTSW 11 83,237,651 (GRCm39) missense probably damaging 1.00
R6416:Ap2b1 UTSW 11 83,199,065 (GRCm39) start codon destroyed probably null 1.00
R6502:Ap2b1 UTSW 11 83,233,505 (GRCm39) missense probably damaging 0.97
R6810:Ap2b1 UTSW 11 83,226,317 (GRCm39) missense possibly damaging 0.89
R6969:Ap2b1 UTSW 11 83,280,552 (GRCm39) missense probably damaging 0.99
R7238:Ap2b1 UTSW 11 83,223,948 (GRCm39) missense possibly damaging 0.91
R7241:Ap2b1 UTSW 11 83,241,931 (GRCm39) missense probably benign 0.16
R7429:Ap2b1 UTSW 11 83,258,824 (GRCm39) missense probably benign 0.00
R7588:Ap2b1 UTSW 11 83,215,348 (GRCm39) missense probably benign 0.00
R7635:Ap2b1 UTSW 11 83,280,554 (GRCm39) missense probably benign 0.09
R7651:Ap2b1 UTSW 11 83,230,256 (GRCm39) critical splice donor site probably null
R7753:Ap2b1 UTSW 11 83,258,733 (GRCm39) nonsense probably null
R8468:Ap2b1 UTSW 11 83,241,891 (GRCm39) missense probably damaging 1.00
R8943:Ap2b1 UTSW 11 83,237,579 (GRCm39) missense probably damaging 1.00
R9093:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
R9621:Ap2b1 UTSW 11 83,293,424 (GRCm39) missense probably damaging 1.00
X0064:Ap2b1 UTSW 11 83,215,395 (GRCm39) missense probably damaging 1.00
Z1177:Ap2b1 UTSW 11 83,256,579 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGTCCAACATCACCCATAGG -3'
(R):5'- TGACCCACCACAATCATGTTAAATG -3'

Sequencing Primer
(F):5'- CCAGTGTGTGTTCTAGTTCAATCAAG -3'
(R):5'- TGTTAAATGTGAAAAGAAGTAGCCAC -3'
Posted On 2015-10-08