Mutagenetix > Incidental Mutation

Incidental Mutation 'R3983:Ap2b1'

350700

Institutional Source

Beutler Lab

Gene Symbol

Ap2b1

Ensembl Gene

ENSMUSG00000035152

Gene Name

adaptor-related protein complex 2, beta 1 subunit

Synonyms

1300012O03Rik

MMRRC Submission

040944-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R3983 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

83299024-83405035 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 83390716 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 816 (T816M)

Ref Sequence

ENSEMBL: ENSMUSP00000135445 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018875] [ENSMUST00000065692] [ENSMUST00000176430] [ENSMUST00000176523]

AlphaFold

Q9DBG3

Predicted Effect

probably damaging
Transcript: ENSMUST00000018875
AA Change: T854M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000018875
Gene: ENSMUSG00000035152
AA Change: T854M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	2.6e-173	PFAM
Pfam:HEAT_2	88	157	3.7e-8	PFAM
Pfam:Cnd1	99	268	2.1e-40	PFAM
Pfam:HEAT_2	124	219	1.4e-9	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	950	9.93e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065692
AA Change: T840M

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070714
Gene: ENSMUSG00000035152
AA Change: T840M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4.2e-173	PFAM
Pfam:HEAT_2	88	157	2.7e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
Alpha_adaptinC2	707	817	2.94e-18	SMART
B2-adapt-app_C	826	936	9.93e-56	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000176430
AA Change: T854M

PolyPhen 2 Score 0.565 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000134779
Gene: ENSMUSG00000035152
AA Change: T854M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	534	4e-173	PFAM
Pfam:HEAT_2	88	157	2.8e-8	PFAM
Pfam:Cnd1	99	268	1.5e-37	PFAM
low complexity region	625	643	N/A	INTRINSIC
low complexity region	654	675	N/A	INTRINSIC
Alpha_adaptinC2	721	831	2.94e-18	SMART
B2-adapt-app_C	840	936	7.22e-35	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000176523
AA Change: T816M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135445
Gene: ENSMUSG00000035152
AA Change: T816M

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	10	95	1.1e-26	PFAM
Pfam:Cnd1	69	230	1.5e-26	PFAM
Pfam:HEAT_2	85	182	5.1e-9	PFAM
Pfam:Adaptin_N	90	496	4e-125	PFAM
low complexity region	587	605	N/A	INTRINSIC
low complexity region	616	637	N/A	INTRINSIC
Alpha_adaptinC2	683	793	2.94e-18	SMART
B2-adapt-app_C	802	912	9.93e-56	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.5%

Validation Efficiency

100% (65/65)

MGI Phenotype

PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit cleft palate. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700093K21Rik	T	A	11: 23,517,220	N138Y	possibly damaging	Het
4921504E06Rik	A	G	2: 19,542,369		probably null	Het
Abcc6	T	C	7: 45,995,289	I821V	probably benign	Het
Adam34	G	A	8: 43,650,769	T613I	probably benign	Het
AF067061	G	T	13: 120,264,279	A160S	possibly damaging	Het
BC005561	T	C	5: 104,521,023	V1137A	probably benign	Het
Cct2	G	A	10: 117,054,135	P10L	probably damaging	Het
Cdc23	C	A	18: 34,637,486		probably benign	Het
Chrna2	G	T	14: 66,149,457	V351L	probably benign	Het
Clca3a1	T	A	3: 144,755,309	T194S	probably benign	Het
Col18a1	C	A	10: 77,088,887	D23Y	probably damaging	Het
Cyp2c50	A	C	19: 40,113,518	K400T	possibly damaging	Het
Cyp2c54	G	T	19: 40,046,255	Q324K	possibly damaging	Het
Dcpp2	T	A	17: 23,900,573	Y120*	probably null	Het
Ddx11	C	T	17: 66,134,130	R242W	probably damaging	Het
Dnah7b	T	A	1: 46,233,711	V2333E	possibly damaging	Het
Eno3	T	A	11: 70,661,411	F296L	probably damaging	Het
Flnc	G	A	6: 29,442,941	V492M	probably damaging	Het
Gdap1	T	G	1: 17,159,907		probably benign	Het
Gm1587	C	T	14: 77,794,843	E118K	unknown	Het
Gm4981	T	A	10: 58,235,801	N197I	possibly damaging	Het
Gprin3	T	C	6: 59,354,560	E254G	possibly damaging	Het
Hcrt	G	A	11: 100,761,853	R112C	probably damaging	Het
Hoxa4	A	T	6: 52,190,677	Y175N	probably benign	Het
Hydin	G	A	8: 110,392,325	G504R	probably damaging	Het
Il1rl1	A	G	1: 40,446,663	R325G	possibly damaging	Het
Kcp	A	T	6: 29,484,637	L1314Q	probably damaging	Het
Kdm5b	C	T	1: 134,631,304	P1522L	possibly damaging	Het
Kmt2d	T	G	15: 98,846,046		probably benign	Het
Map3k20	C	T	2: 72,438,227	T526I	probably damaging	Het
Mfap2	A	G	4: 141,014,243	Q71R	possibly damaging	Het
Mme	T	A	3: 63,328,064	Y178N	probably damaging	Het
Msr1	A	G	8: 39,620,018	V164A	possibly damaging	Het
Mybbp1a	T	C	11: 72,447,170	V646A	probably damaging	Het
Mybpc3	A	T	2: 91,135,369	K1175N	probably benign	Het
Myo1c	T	A	11: 75,661,499	L366Q	probably benign	Het
Olfr105-ps	T	C	17: 37,383,398	V277A	possibly damaging	Het
Olfr308	A	G	7: 86,321,734	Y73H	probably damaging	Het
Olfr381	A	G	11: 73,486,135	S230P	possibly damaging	Het
Palmd	T	C	3: 116,923,823	T342A	probably benign	Het
Pde4d	A	G	13: 109,740,406	T29A	probably benign	Het
Rapgef5	A	G	12: 117,728,670	E563G	possibly damaging	Het
Rdh19	A	G	10: 127,850,148	N43S	probably benign	Het
Rnf44	A	C	13: 54,683,148	S98R	probably damaging	Het
Samhd1	C	A	2: 157,123,449	V149L	possibly damaging	Het
Scn4a	G	T	11: 106,347,818	N214K	probably damaging	Het
Sh3bp4	A	G	1: 89,145,869	N813S	probably benign	Het
Sirt3	A	T	7: 140,878,112	C41*	probably null	Het
Speg	C	A	1: 75,422,547	P2213T	probably benign	Het
Srcin1	T	G	11: 97,525,553	E951A	probably damaging	Het
Syn2	C	G	6: 115,237,298	T161S	probably benign	Het
Tbc1d4	T	C	14: 101,507,213	T326A	probably benign	Het
Tes	T	A	6: 17,099,701		probably null	Het
Tln1	T	C	4: 43,553,030	T354A	probably damaging	Het
Ttn	G	T	2: 76,802,361	S12370R	possibly damaging	Het
Twsg1	T	C	17: 65,929,763	T91A	probably benign	Het
Vmn1r181	C	T	7: 23,984,809	T233I	probably benign	Het
Wee2	A	T	6: 40,455,241	N248I	possibly damaging	Het
Zfp740	G	T	15: 102,208,243	C56F	probably benign	Het

Other mutations in Ap2b1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00864:Ap2b1	APN	11	83333158	missense	probably damaging	0.99
IGL01583:Ap2b1	APN	11	83324611	missense	possibly damaging	0.61
IGL01753:Ap2b1	APN	11	83321973	missense	probably damaging	1.00
IGL01992:Ap2b1	APN	11	83335530	missense	probably damaging	1.00
IGL02192:Ap2b1	APN	11	83346766	missense	possibly damaging	0.48
IGL02315:Ap2b1	APN	11	83336799	missense	probably damaging	0.96
IGL03235:Ap2b1	APN	11	83341384	missense	probably benign	0.41
P0045:Ap2b1	UTSW	11	83368026	missense	probably damaging	1.00
R0121:Ap2b1	UTSW	11	83321967	missense	possibly damaging	0.66
R0334:Ap2b1	UTSW	11	83367874	splice site	probably benign
R1222:Ap2b1	UTSW	11	83346738	missense	probably benign	0.06
R1297:Ap2b1	UTSW	11	83333109	missense	probably damaging	1.00
R1653:Ap2b1	UTSW	11	83346831	missense	probably damaging	1.00
R1719:Ap2b1	UTSW	11	83324604	missense	probably damaging	1.00
R1885:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1886:Ap2b1	UTSW	11	83390735	missense	probably damaging	0.99
R1965:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R1966:Ap2b1	UTSW	11	83346895	missense	probably benign	0.00
R2046:Ap2b1	UTSW	11	83336386	missense	probably benign	0.14
R2086:Ap2b1	UTSW	11	83351118	missense	possibly damaging	0.88
R2132:Ap2b1	UTSW	11	83324761	splice site	probably benign
R3615:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R3616:Ap2b1	UTSW	11	83324565	missense	possibly damaging	0.84
R4124:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4125:Ap2b1	UTSW	11	83365645	critical splice acceptor site	probably null
R4198:Ap2b1	UTSW	11	83342603	missense	probably damaging	1.00
R4202:Ap2b1	UTSW	11	83335604	critical splice donor site	probably null
R4543:Ap2b1	UTSW	11	83324650	missense	probably damaging	1.00
R4583:Ap2b1	UTSW	11	83397779	missense	probably benign	0.00
R4589:Ap2b1	UTSW	11	83333011	nonsense	probably null
R4916:Ap2b1	UTSW	11	83390706	missense	probably damaging	1.00
R5005:Ap2b1	UTSW	11	83339392	missense	probably damaging	1.00
R5385:Ap2b1	UTSW	11	83342601	missense	probably damaging	1.00
R5510:Ap2b1	UTSW	11	83336737	splice site	probably null
R5738:Ap2b1	UTSW	11	83336430	splice site	probably null
R6023:Ap2b1	UTSW	11	83335398	missense	probably damaging	0.99
R6269:Ap2b1	UTSW	11	83346673	missense	probably damaging	1.00
R6383:Ap2b1	UTSW	11	83346825	missense	probably damaging	1.00
R6416:Ap2b1	UTSW	11	83308239	start codon destroyed	probably null	1.00
R6502:Ap2b1	UTSW	11	83342679	missense	probably damaging	0.97
R6810:Ap2b1	UTSW	11	83335491	missense	possibly damaging	0.89
R6969:Ap2b1	UTSW	11	83389726	missense	probably damaging	0.99
R7238:Ap2b1	UTSW	11	83333122	missense	possibly damaging	0.91
R7241:Ap2b1	UTSW	11	83351105	missense	probably benign	0.16
R7429:Ap2b1	UTSW	11	83367998	missense	probably benign	0.00
R7588:Ap2b1	UTSW	11	83324522	missense	probably benign	0.00
R7635:Ap2b1	UTSW	11	83389728	missense	probably benign	0.09
R7651:Ap2b1	UTSW	11	83339430	critical splice donor site	probably null
R7753:Ap2b1	UTSW	11	83367907	nonsense	probably null
R8468:Ap2b1	UTSW	11	83351065	missense	probably damaging	1.00
R8943:Ap2b1	UTSW	11	83346753	missense	probably damaging	1.00
R9093:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
R9621:Ap2b1	UTSW	11	83402598	missense	probably damaging	1.00
X0064:Ap2b1	UTSW	11	83324569	missense	probably damaging	1.00
Z1177:Ap2b1	UTSW	11	83365753	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- GTGTCCAACATCACCCATAGG -3'
(R):5'- TGACCCACCACAATCATGTTAAATG -3'

Sequencing Primer
(F):5'- CCAGTGTGTGTTCTAGTTCAATCAAG -3'
(R):5'- TGTTAAATGTGAAAAGAAGTAGCCAC -3'

Posted On

2015-10-08