Incidental Mutation 'R3983:Scn4a'
ID350703
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
MMRRC Submission 040944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3983 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 106347818 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 214 (N214K)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: N214K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: N214K

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174877
Meta Mutation Damage Score 0.3717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,517,220 N138Y possibly damaging Het
4921504E06Rik A G 2: 19,542,369 probably null Het
Abcc6 T C 7: 45,995,289 I821V probably benign Het
Adam34 G A 8: 43,650,769 T613I probably benign Het
AF067061 G T 13: 120,264,279 A160S possibly damaging Het
Ap2b1 C T 11: 83,390,716 T816M probably damaging Het
BC005561 T C 5: 104,521,023 V1137A probably benign Het
Cct2 G A 10: 117,054,135 P10L probably damaging Het
Cdc23 C A 18: 34,637,486 probably benign Het
Chrna2 G T 14: 66,149,457 V351L probably benign Het
Clca3a1 T A 3: 144,755,309 T194S probably benign Het
Col18a1 C A 10: 77,088,887 D23Y probably damaging Het
Cyp2c50 A C 19: 40,113,518 K400T possibly damaging Het
Cyp2c54 G T 19: 40,046,255 Q324K possibly damaging Het
Dcpp2 T A 17: 23,900,573 Y120* probably null Het
Ddx11 C T 17: 66,134,130 R242W probably damaging Het
Dnah7b T A 1: 46,233,711 V2333E possibly damaging Het
Eno3 T A 11: 70,661,411 F296L probably damaging Het
Flnc G A 6: 29,442,941 V492M probably damaging Het
Gdap1 T G 1: 17,159,907 probably benign Het
Gm1587 C T 14: 77,794,843 E118K unknown Het
Gm4981 T A 10: 58,235,801 N197I possibly damaging Het
Gprin3 T C 6: 59,354,560 E254G possibly damaging Het
Hcrt G A 11: 100,761,853 R112C probably damaging Het
Hoxa4 A T 6: 52,190,677 Y175N probably benign Het
Hydin G A 8: 110,392,325 G504R probably damaging Het
Il1rl1 A G 1: 40,446,663 R325G possibly damaging Het
Kcp A T 6: 29,484,637 L1314Q probably damaging Het
Kdm5b C T 1: 134,631,304 P1522L possibly damaging Het
Kmt2d T G 15: 98,846,046 probably benign Het
Map3k20 C T 2: 72,438,227 T526I probably damaging Het
Mfap2 A G 4: 141,014,243 Q71R possibly damaging Het
Mme T A 3: 63,328,064 Y178N probably damaging Het
Msr1 A G 8: 39,620,018 V164A possibly damaging Het
Mybbp1a T C 11: 72,447,170 V646A probably damaging Het
Mybpc3 A T 2: 91,135,369 K1175N probably benign Het
Myo1c T A 11: 75,661,499 L366Q probably benign Het
Olfr105-ps T C 17: 37,383,398 V277A possibly damaging Het
Olfr308 A G 7: 86,321,734 Y73H probably damaging Het
Olfr381 A G 11: 73,486,135 S230P possibly damaging Het
Palmd T C 3: 116,923,823 T342A probably benign Het
Pde4d A G 13: 109,740,406 T29A probably benign Het
Rapgef5 A G 12: 117,728,670 E563G possibly damaging Het
Rdh19 A G 10: 127,850,148 N43S probably benign Het
Rnf44 A C 13: 54,683,148 S98R probably damaging Het
Samhd1 C A 2: 157,123,449 V149L possibly damaging Het
Sh3bp4 A G 1: 89,145,869 N813S probably benign Het
Sirt3 A T 7: 140,878,112 C41* probably null Het
Speg C A 1: 75,422,547 P2213T probably benign Het
Srcin1 T G 11: 97,525,553 E951A probably damaging Het
Syn2 C G 6: 115,237,298 T161S probably benign Het
Tbc1d4 T C 14: 101,507,213 T326A probably benign Het
Tes T A 6: 17,099,701 probably null Het
Tln1 T C 4: 43,553,030 T354A probably damaging Het
Ttn G T 2: 76,802,361 S12370R possibly damaging Het
Twsg1 T C 17: 65,929,763 T91A probably benign Het
Vmn1r181 C T 7: 23,984,809 T233I probably benign Het
Wee2 A T 6: 40,455,241 N248I possibly damaging Het
Zfp740 G T 15: 102,208,243 C56F probably benign Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5407:Scn4a UTSW 11 106320889 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGCCCTAGAAGATGCTGTTTTAAG -3'
(R):5'- GGCTAAAACAGGACCTTTGGG -3'

Sequencing Primer
(F):5'- ACAGATCGGTGGTTCTCAAC -3'
(R):5'- CTAAAACAGGACCTTTGGGGGTTTTG -3'
Posted On2015-10-08