Incidental Mutation 'R3983:Tcstv2a'
ID 350707
Institutional Source Beutler Lab
Gene Symbol Tcstv2a
Ensembl Gene ENSMUSG00000095071
Gene Name 2 cell stage variable group member 2A
Synonyms AF067061, clone L8 variable group of 2-cell-stage gene family, clone L4 variable group of 2-cell-stage gene family
MMRRC Submission 040944-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.559) question?
Stock # R3983 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 120724650-120726053 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 120725815 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 160 (A160S)
Ref Sequence ENSEMBL: ENSMUSP00000137949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000179905] [ENSMUST00000181748]
AlphaFold O70616
Predicted Effect possibly damaging
Transcript: ENSMUST00000179905
AA Change: A160S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000136309
Gene: ENSMUSG00000095071
AA Change: A160S

DomainStartEndE-ValueType
Pfam:DUF1438 7 157 1.3e-95 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000181748
AA Change: A160S

PolyPhen 2 Score 0.925 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000137949
Gene: ENSMUSG00000095071
AA Change: A160S

DomainStartEndE-ValueType
Pfam:DUF1438 7 157 4.3e-94 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700093K21Rik T A 11: 23,467,220 (GRCm39) N138Y possibly damaging Het
4921504E06Rik A G 2: 19,547,180 (GRCm39) probably null Het
Abcc6 T C 7: 45,644,713 (GRCm39) I821V probably benign Het
Adam34 G A 8: 44,103,806 (GRCm39) T613I probably benign Het
Ap2b1 C T 11: 83,281,542 (GRCm39) T816M probably damaging Het
Cct2 G A 10: 116,890,040 (GRCm39) P10L probably damaging Het
Cdc23 C A 18: 34,770,539 (GRCm39) probably benign Het
Chrna2 G T 14: 66,386,906 (GRCm39) V351L probably benign Het
Clca3a1 T A 3: 144,461,070 (GRCm39) T194S probably benign Het
Col18a1 C A 10: 76,924,721 (GRCm39) D23Y probably damaging Het
Cyp2c50 A C 19: 40,101,962 (GRCm39) K400T possibly damaging Het
Cyp2c54 G T 19: 40,034,699 (GRCm39) Q324K possibly damaging Het
Dcpp2 T A 17: 24,119,547 (GRCm39) Y120* probably null Het
Ddx11 C T 17: 66,441,125 (GRCm39) R242W probably damaging Het
Dnah7b T A 1: 46,272,871 (GRCm39) V2333E possibly damaging Het
Duxf4 T A 10: 58,071,623 (GRCm39) N197I possibly damaging Het
Eno3 T A 11: 70,552,237 (GRCm39) F296L probably damaging Het
Flnc G A 6: 29,442,940 (GRCm39) V492M probably damaging Het
Gdap1 T G 1: 17,230,131 (GRCm39) probably benign Het
Gm1587 C T 14: 78,032,283 (GRCm39) E118K unknown Het
Gprin3 T C 6: 59,331,545 (GRCm39) E254G possibly damaging Het
Hcrt G A 11: 100,652,679 (GRCm39) R112C probably damaging Het
Hoxa4 A T 6: 52,167,657 (GRCm39) Y175N probably benign Het
Hydin G A 8: 111,118,957 (GRCm39) G504R probably damaging Het
Il1rl1 A G 1: 40,485,823 (GRCm39) R325G possibly damaging Het
Kcp A T 6: 29,484,636 (GRCm39) L1314Q probably damaging Het
Kdm5b C T 1: 134,559,042 (GRCm39) P1522L possibly damaging Het
Kmt2d T G 15: 98,743,927 (GRCm39) probably benign Het
Map3k20 C T 2: 72,268,571 (GRCm39) T526I probably damaging Het
Mfap2 A G 4: 140,741,554 (GRCm39) Q71R possibly damaging Het
Mme T A 3: 63,235,485 (GRCm39) Y178N probably damaging Het
Msr1 A G 8: 40,073,059 (GRCm39) V164A possibly damaging Het
Mybbp1a T C 11: 72,337,996 (GRCm39) V646A probably damaging Het
Mybpc3 A T 2: 90,965,714 (GRCm39) K1175N probably benign Het
Myo1c T A 11: 75,552,325 (GRCm39) L366Q probably benign Het
Or12d15 T C 17: 37,694,289 (GRCm39) V277A possibly damaging Het
Or1e22 A G 11: 73,376,961 (GRCm39) S230P possibly damaging Het
Or6f1 A G 7: 85,970,942 (GRCm39) Y73H probably damaging Het
Palmd T C 3: 116,717,472 (GRCm39) T342A probably benign Het
Pde4d A G 13: 109,876,940 (GRCm39) T29A probably benign Het
Rapgef5 A G 12: 117,692,405 (GRCm39) E563G possibly damaging Het
Rdh19 A G 10: 127,686,017 (GRCm39) N43S probably benign Het
Rnf44 A C 13: 54,830,961 (GRCm39) S98R probably damaging Het
Samhd1 C A 2: 156,965,369 (GRCm39) V149L possibly damaging Het
Scn4a G T 11: 106,238,644 (GRCm39) N214K probably damaging Het
Sh3bp4 A G 1: 89,073,591 (GRCm39) N813S probably benign Het
Sirt3 A T 7: 140,458,025 (GRCm39) C41* probably null Het
Speg C A 1: 75,399,191 (GRCm39) P2213T probably benign Het
Srcin1 T G 11: 97,416,379 (GRCm39) E951A probably damaging Het
Syn2 C G 6: 115,214,259 (GRCm39) T161S probably benign Het
Tbc1d4 T C 14: 101,744,649 (GRCm39) T326A probably benign Het
Tes T A 6: 17,099,700 (GRCm39) probably null Het
Thoc2l T C 5: 104,668,889 (GRCm39) V1137A probably benign Het
Tln1 T C 4: 43,553,030 (GRCm39) T354A probably damaging Het
Ttn G T 2: 76,632,705 (GRCm39) S12370R possibly damaging Het
Twsg1 T C 17: 66,236,758 (GRCm39) T91A probably benign Het
Vmn1r181 C T 7: 23,684,234 (GRCm39) T233I probably benign Het
Wee2 A T 6: 40,432,175 (GRCm39) N248I possibly damaging Het
Zfp740 G T 15: 102,116,678 (GRCm39) C56F probably benign Het
Other mutations in Tcstv2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1435:Tcstv2a UTSW 13 120,725,524 (GRCm39) missense probably damaging 1.00
R1887:Tcstv2a UTSW 13 120,725,604 (GRCm39) missense probably damaging 1.00
R2165:Tcstv2a UTSW 13 120,725,633 (GRCm39) missense probably damaging 0.97
R2517:Tcstv2a UTSW 13 120,725,475 (GRCm39) nonsense probably null
R4471:Tcstv2a UTSW 13 120,725,579 (GRCm39) missense probably benign
R4822:Tcstv2a UTSW 13 120,725,686 (GRCm39) missense probably damaging 0.99
R5775:Tcstv2a UTSW 13 120,725,475 (GRCm39) nonsense probably null
R6251:Tcstv2a UTSW 13 120,724,907 (GRCm39) intron probably benign
R8922:Tcstv2a UTSW 13 120,725,666 (GRCm39) missense probably benign 0.45
R9011:Tcstv2a UTSW 13 120,725,746 (GRCm39) missense probably damaging 0.98
R9659:Tcstv2a UTSW 13 120,725,754 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GAATTCTGCCATGAAGAAGGGC -3'
(R):5'- GATGGCTGCAAAGACACAAC -3'

Sequencing Primer
(F):5'- CACAGAGGTCTTCCAGAGTG -3'
(R):5'- TGCAAAGACACAACTGCCTTTG -3'
Posted On 2015-10-08