Incidental Mutation 'R4636:Fam131b'
ID350735
Institutional Source Beutler Lab
Gene Symbol Fam131b
Ensembl Gene ENSMUSG00000029861
Gene Namefamily with sequence similarity 131, member B
Synonyms6330503C03Rik, 6530406I18Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4636 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location42315312-42324643 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42320980 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 92 (S92P)
Ref Sequence ENSEMBL: ENSMUSP00000116779 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031891] [ENSMUST00000095974] [ENSMUST00000143278]
Predicted Effect probably damaging
Transcript: ENSMUST00000031891
AA Change: S80P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031891
Gene: ENSMUSG00000029861
AA Change: S80P

DomainStartEndE-ValueType
Pfam:FAM131 49 341 7.4e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000095974
AA Change: S64P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093670
Gene: ENSMUSG00000029861
AA Change: S64P

DomainStartEndE-ValueType
Pfam:FAM131 33 325 4.5e-128 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143278
AA Change: S92P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116779
Gene: ENSMUSG00000029861
AA Change: S92P

DomainStartEndE-ValueType
Pfam:FAM131 61 353 1.9e-113 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcs T C 1: 172,894,422 E119G probably damaging Het
Arhgef5 A G 6: 43,274,942 T876A probably benign Het
Arih2 A T 9: 108,613,814 C227S probably damaging Het
Bsn A T 9: 108,115,424 L1043Q probably damaging Het
Cyp2d34 G C 15: 82,620,728 P44A probably damaging Het
Ddx59 T A 1: 136,432,563 N438K probably damaging Het
Esr2 A G 12: 76,123,324 M447T possibly damaging Het
Galnt9 A G 5: 110,615,499 M457V probably damaging Het
Gorasp2 T A 2: 70,679,492 Y166N probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Lmf1 G A 17: 25,654,471 V317M probably damaging Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Mrpl1 G T 5: 96,210,175 V5L probably benign Het
Nifk T A 1: 118,329,487 Y117N possibly damaging Het
Notch2 A G 3: 98,146,104 K2028E probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Prpf3 A G 3: 95,834,170 F558S probably damaging Het
Rabgap1l T C 1: 160,342,090 probably null Het
Rasa2 C T 9: 96,544,337 D819N probably benign Het
Rbl1 T A 2: 157,167,420 T732S possibly damaging Het
Slc14a2 A G 18: 78,195,792 V204A possibly damaging Het
Ttn A C 2: 76,813,593 L13097R probably damaging Het
Wdpcp A G 11: 21,711,568 E280G probably benign Het
Znhit6 A G 3: 145,600,578 silent Het
Znhit6 G T 3: 145,600,579 V280L probably null Het
Other mutations in Fam131b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Fam131b APN 6 42318961 missense probably damaging 1.00
IGL01328:Fam131b APN 6 42318272 missense probably damaging 1.00
IGL02948:Fam131b APN 6 42320992 splice site probably benign
IGL03226:Fam131b APN 6 42318954 missense possibly damaging 0.81
R0027:Fam131b UTSW 6 42318248 missense probably benign 0.01
R0027:Fam131b UTSW 6 42318248 missense probably benign 0.01
R1730:Fam131b UTSW 6 42318580 missense possibly damaging 0.75
R1783:Fam131b UTSW 6 42318580 missense possibly damaging 0.75
R1858:Fam131b UTSW 6 42318980 missense probably damaging 1.00
R1993:Fam131b UTSW 6 42320884 missense possibly damaging 0.94
R1994:Fam131b UTSW 6 42320884 missense possibly damaging 0.94
R4275:Fam131b UTSW 6 42321307 missense probably damaging 1.00
R5876:Fam131b UTSW 6 42321248 critical splice donor site probably null
R5877:Fam131b UTSW 6 42320979 missense probably benign 0.09
R5979:Fam131b UTSW 6 42321971 missense probably damaging 0.98
R7725:Fam131b UTSW 6 42318542 missense probably benign 0.01
Z1177:Fam131b UTSW 6 42318920 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- CTAGGAAACGTGCCTCCTTC -3'
(R):5'- TTTCCTTAAGCCTGATGGGG -3'

Sequencing Primer
(F):5'- CTCGCCATCACTGAGGTCAGAG -3'
(R):5'- TCCGAATCACCTGGTTTTATGTCAAG -3'
Posted On2015-10-08