Mutagenetix > Incidental Mutation

Incidental Mutation 'R4636:Esr2'

350743

Institutional Source

Beutler Lab

Gene Symbol

Esr2

Ensembl Gene

ENSMUSG00000021055

Gene Name

estrogen receptor 2 (beta)

Synonyms

ERbeta, oestrogen receptor beta, Estrb, ER beta

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.648) question?

Stock #

R4636 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

76167193-76224033 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 76170098 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 447 (M447T)

Ref Sequence

ENSEMBL: ENSMUSP00000151463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076634] [ENSMUST00000101291] [ENSMUST00000110421] [ENSMUST00000133564] [ENSMUST00000218621]

AlphaFold

O08537

Predicted Effect

probably benign
Transcript: ENSMUST00000076634
AA Change: M429T

PolyPhen 2 Score 0.070 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075932
Gene: ENSMUSG00000021055
AA Change: M429T

Domain	Start	End	E-Value	Type
Pfam:ERbeta_N	31	143	4.2e-41	PFAM
ZnF_C4	165	236	1.84e-34	SMART
HOLI	319	488	5.99e-34	SMART
Blast:HOLI	489	519	7e-8	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000101291
AA Change: M428T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098849
Gene: ENSMUSG00000021055
AA Change: M428T

Domain	Start	End	E-Value	Type
Pfam:ERbeta_N	31	141	1.9e-56	PFAM
ZnF_C4	165	236	1.84e-34	SMART
HOLI	319	506	6.88e-34	SMART
Blast:HOLI	507	537	8e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000110421
AA Change: M410T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106051
Gene: ENSMUSG00000021055
AA Change: M410T

Domain	Start	End	E-Value	Type
Pfam:ERbeta_N	31	143	4.2e-41	PFAM
ZnF_C4	165	236	1.84e-34	SMART
HOLI	319	488	5.99e-34	SMART
Blast:HOLI	489	519	7e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000133564

SMART Domains

Protein: ENSMUSP00000138637
Gene: ENSMUSG00000021055

Domain	Start	End	E-Value	Type
Pfam:ERbeta_N	31	143	1.1e-41	PFAM
ZnF_C4	165	236	1.84e-34	SMART
PDB:2J7Y\|A	274	337	1e-33	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000218621
AA Change: M447T

PolyPhen 2 Score 0.505 (Sensitivity: 0.88; Specificity: 0.90)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the family of estrogen receptors and superfamily of nuclear receptor transcription factors. The gene product contains an N-terminal DNA binding domain and C-terminal ligand binding domain and is localized to the nucleus, cytoplasm, and mitochondria. Upon binding to 17beta-estradiol or related ligands, the encoded protein forms homo- or hetero-dimers that interact with specific DNA sequences to activate transcription. Some isoforms dominantly inhibit the activity of other estrogen receptor family members. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been fully characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neural, behavior, glucose homeostasis, sex-specific nociception, cardiac, and ion channel abnormalities and myeloproliferative disorders. Females are sterile/subfertile with granulosa cell defects; males show prostate hyperplasia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 26 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcs	T	C	1: 172,721,989 (GRCm39)	E119G	probably damaging	Het
Arhgef5	A	G	6: 43,251,876 (GRCm39)	T876A	probably benign	Het
Arih2	A	T	9: 108,491,013 (GRCm39)	C227S	probably damaging	Het
Bsn	A	T	9: 107,992,623 (GRCm39)	L1043Q	probably damaging	Het
Cyp2d34	G	C	15: 82,504,929 (GRCm39)	P44A	probably damaging	Het
Ddx59	T	A	1: 136,360,301 (GRCm39)	N438K	probably damaging	Het
Fam131b	A	G	6: 42,297,914 (GRCm39)	S92P	probably damaging	Het
Galnt9	A	G	5: 110,763,365 (GRCm39)	M457V	probably damaging	Het
Gorasp2	T	A	2: 70,509,836 (GRCm39)	Y166N	probably damaging	Het
Gpat3	C	T	5: 101,005,039 (GRCm39)	P58L	probably benign	Het
Hivep2	C	A	10: 14,004,713 (GRCm39)	T437K	probably benign	Het
Lmf1	G	A	17: 25,873,445 (GRCm39)	V317M	probably damaging	Het
Lrp2	T	C	2: 69,266,983 (GRCm39)	E4308G	possibly damaging	Het
Mrpl1	G	T	5: 96,358,034 (GRCm39)	V5L	probably benign	Het
Nifk	T	A	1: 118,257,217 (GRCm39)	Y117N	possibly damaging	Het
Notch2	A	G	3: 98,053,420 (GRCm39)	K2028E	probably benign	Het
Or4a76	A	C	2: 89,460,516 (GRCm39)	I242S	possibly damaging	Het
Prpf3	A	G	3: 95,741,482 (GRCm39)	F558S	probably damaging	Het
Rabgap1l	T	C	1: 160,169,660 (GRCm39)		probably null	Het
Rasa2	C	T	9: 96,426,390 (GRCm39)	D819N	probably benign	Het
Rbl1	T	A	2: 157,009,340 (GRCm39)	T732S	possibly damaging	Het
Slc14a2	A	G	18: 78,239,007 (GRCm39)	V204A	possibly damaging	Het
Ttn	A	C	2: 76,643,937 (GRCm39)	L13097R	probably damaging	Het
Wdpcp	A	G	11: 21,661,568 (GRCm39)	E280G	probably benign	Het
Znhit6	G	T	3: 145,306,334 (GRCm39)	V280L	probably null	Het
Znhit6	A	G	3: 145,306,333 (GRCm39)		silent	Het

Other mutations in Esr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00094:Esr2	APN	12	76,180,670 (GRCm39)	missense	probably damaging	1.00
IGL00435:Esr2	APN	12	76,180,653 (GRCm39)	missense	probably damaging	1.00
IGL01591:Esr2	APN	12	76,168,498 (GRCm39)	utr 3 prime	probably benign
IGL01695:Esr2	APN	12	76,192,093 (GRCm39)	missense	probably damaging	1.00
IGL02142:Esr2	APN	12	76,169,969 (GRCm39)	missense	probably benign	0.02
IGL02343:Esr2	APN	12	76,192,119 (GRCm39)	missense	probably benign	0.01
IGL02584:Esr2	APN	12	76,192,036 (GRCm39)	missense	probably damaging	1.00
R0380:Esr2	UTSW	12	76,170,065 (GRCm39)	missense	possibly damaging	0.81
R0975:Esr2	UTSW	12	76,192,082 (GRCm39)	missense	possibly damaging	0.49
R2075:Esr2	UTSW	12	76,212,221 (GRCm39)	critical splice donor site	probably null
R3881:Esr2	UTSW	12	76,214,394 (GRCm39)	missense	probably damaging	0.96
R4475:Esr2	UTSW	12	76,180,716 (GRCm39)	missense	probably benign	0.04
R4520:Esr2	UTSW	12	76,214,323 (GRCm39)	missense	possibly damaging	0.91
R5167:Esr2	UTSW	12	76,170,048 (GRCm39)	missense	probably benign	0.00
R6163:Esr2	UTSW	12	76,168,643 (GRCm39)	missense	probably damaging	1.00
R6928:Esr2	UTSW	12	76,212,252 (GRCm39)	missense	probably damaging	1.00
R6965:Esr2	UTSW	12	76,168,631 (GRCm39)	missense	probably damaging	0.97
R7441:Esr2	UTSW	12	76,188,168 (GRCm39)	missense	probably benign	0.01
R9063:Esr2	UTSW	12	76,168,590 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- GTACCTGATGTGCCTGACATGAG -3'
(R):5'- AGCCAGGATTCCCTTACAGC -3'

Sequencing Primer
(F):5'- TGCCTGACATGAGAAAGAAGCATC -3'
(R):5'- CAGGATTCCCTTACAGCTTGGTG -3'

Posted On

2015-10-08