Incidental Mutation 'R4636:Lmf1'
ID350747
Institutional Source Beutler Lab
Gene Symbol Lmf1
Ensembl Gene ENSMUSG00000002279
Gene Namelipase maturation factor 1
SynonymsTmem112, 2400010G15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4636 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location25579174-25662826 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 25654471 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 317 (V317M)
Ref Sequence ENSEMBL: ENSMUSP00000112340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063344] [ENSMUST00000116641] [ENSMUST00000137201]
Predicted Effect probably damaging
Transcript: ENSMUST00000063344
AA Change: V317M

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066682
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 551 2.3e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000116641
AA Change: V317M

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112340
Gene: ENSMUSG00000002279
AA Change: V317M

DomainStartEndE-ValueType
transmembrane domain 50 72 N/A INTRINSIC
transmembrane domain 97 119 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
Pfam:LMF1 169 553 1.2e-148 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137201
Predicted Effect probably benign
Transcript: ENSMUST00000141606
SMART Domains Protein: ENSMUSP00000129263
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
Pfam:LMF1 2 90 9.8e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154842
SMART Domains Protein: ENSMUSP00000119563
Gene: ENSMUSG00000002279

DomainStartEndE-ValueType
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 94 116 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:LMF1 166 298 2.4e-60 PFAM
Meta Mutation Damage Score 0.8099 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene resides in the endoplasmic reticulum, and is involved in the maturation and transport of lipoprotein lipase through the secretory pathway. Mutations in this gene are associated with combined lipase deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mutations in this gene result in neonatal death following progressive cyanosis, combined lipase deficiency, and hypertriglyceridemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcs T C 1: 172,894,422 E119G probably damaging Het
Arhgef5 A G 6: 43,274,942 T876A probably benign Het
Arih2 A T 9: 108,613,814 C227S probably damaging Het
Bsn A T 9: 108,115,424 L1043Q probably damaging Het
Cyp2d34 G C 15: 82,620,728 P44A probably damaging Het
Ddx59 T A 1: 136,432,563 N438K probably damaging Het
Esr2 A G 12: 76,123,324 M447T possibly damaging Het
Fam131b A G 6: 42,320,980 S92P probably damaging Het
Galnt9 A G 5: 110,615,499 M457V probably damaging Het
Gorasp2 T A 2: 70,679,492 Y166N probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Lrp2 T C 2: 69,436,639 E4308G possibly damaging Het
Mrpl1 G T 5: 96,210,175 V5L probably benign Het
Nifk T A 1: 118,329,487 Y117N possibly damaging Het
Notch2 A G 3: 98,146,104 K2028E probably benign Het
Olfr1249 A C 2: 89,630,172 I242S possibly damaging Het
Prpf3 A G 3: 95,834,170 F558S probably damaging Het
Rabgap1l T C 1: 160,342,090 probably null Het
Rasa2 C T 9: 96,544,337 D819N probably benign Het
Rbl1 T A 2: 157,167,420 T732S possibly damaging Het
Slc14a2 A G 18: 78,195,792 V204A possibly damaging Het
Ttn A C 2: 76,813,593 L13097R probably damaging Het
Wdpcp A G 11: 21,711,568 E280G probably benign Het
Znhit6 A G 3: 145,600,578 silent Het
Znhit6 G T 3: 145,600,579 V280L probably null Het
Other mutations in Lmf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03153:Lmf1 APN 17 25585650 missense possibly damaging 0.51
R0117:Lmf1 UTSW 17 25655991 unclassified probably benign
R1757:Lmf1 UTSW 17 25655210 missense probably damaging 1.00
R1906:Lmf1 UTSW 17 25612335 missense probably damaging 0.99
R2389:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R2446:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3797:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3798:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3855:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3953:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3955:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R3956:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4290:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4291:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4293:Lmf1 UTSW 17 25654481 missense probably damaging 1.00
R4698:Lmf1 UTSW 17 25579350 missense probably damaging 0.98
R4791:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4792:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R4968:Lmf1 UTSW 17 25585618 missense probably damaging 1.00
R4997:Lmf1 UTSW 17 25588676 nonsense probably null
R5047:Lmf1 UTSW 17 25631838 intron probably benign
R5152:Lmf1 UTSW 17 25655519 missense probably damaging 0.99
R5419:Lmf1 UTSW 17 25662636 missense possibly damaging 0.94
R6162:Lmf1 UTSW 17 25612394 missense probably benign 0.00
R6693:Lmf1 UTSW 17 25645278 missense probably benign 0.00
R7583:Lmf1 UTSW 17 25655449 missense
R7642:Lmf1 UTSW 17 25654471 missense probably damaging 1.00
R7667:Lmf1 UTSW 17 25654608 critical splice donor site probably null
R7671:Lmf1 UTSW 17 25579349 missense possibly damaging 0.75
R7818:Lmf1 UTSW 17 25662591 missense probably benign 0.30
R8851:Lmf1 UTSW 17 25585706 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTTGGGACCAGAACTGAGAG -3'
(R):5'- TTTCATGAGGCTTAGGCAGG -3'

Sequencing Primer
(F):5'- CTTGGGACCAGAACTGAGAGAATGG -3'
(R):5'- GCTTAGGCAGGAGGGTCATG -3'
Posted On2015-10-08