Incidental Mutation 'R4637:Slc16a14'
ID 350749
Institutional Source Beutler Lab
Gene Symbol Slc16a14
Ensembl Gene ENSMUSG00000026220
Gene Name solute carrier family 16 (monocarboxylic acid transporters), member 14
Synonyms 1110004H10Rik
MMRRC Submission 042010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock # R4637 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 84905898-84935134 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 84907282 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 512 (V512A)
Ref Sequence ENSEMBL: ENSMUSP00000027422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027422]
AlphaFold Q8K1C7
Predicted Effect possibly damaging
Transcript: ENSMUST00000027422
AA Change: V512A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000027422
Gene: ENSMUSG00000026220
AA Change: V512A

DomainStartEndE-ValueType
Pfam:MFS_1 42 427 6.7e-42 PFAM
Pfam:MFS_1 419 509 7.9e-10 PFAM
Meta Mutation Damage Score 0.0889 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930548H24Rik G A 5: 31,488,091 R396Q probably benign Het
Art1 T A 7: 102,106,337 V12E probably damaging Het
Ccdc180 A G 4: 45,914,443 S653G probably benign Het
Clic6 T C 16: 92,497,061 probably benign Het
Fras1 T A 5: 96,778,088 L3717Q probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Gtf2f1 G T 17: 57,004,534 P292H probably benign Het
Hcn1 A T 13: 117,975,713 T738S unknown Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmbs A G 9: 44,339,537 S130P probably damaging Het
Kif1b A T 4: 149,199,311 I1299N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc3 A T 5: 137,146,654 L56Q probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nol6 G A 4: 41,121,788 R249W probably damaging Het
Olfr1284 C T 2: 111,379,582 T194I probably benign Het
Pcdhb1 T C 18: 37,265,749 V251A possibly damaging Het
Prkcd A G 14: 30,598,765 S633P probably benign Het
Rarb T C 14: 16,574,875 H47R possibly damaging Het
Slc34a3 C T 2: 25,229,461 V466M possibly damaging Het
Stat3 A G 11: 100,893,230 S623P probably damaging Het
Vmn2r16 T G 5: 109,330,414 S12A probably benign Het
Zfhx4 C G 3: 5,403,404 P2874R probably damaging Het
Zfp3 T C 11: 70,771,355 S47P probably benign Het
Zfp791 T C 8: 85,109,885 E450G possibly damaging Het
Other mutations in Slc16a14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Slc16a14 APN 1 84922871 missense probably damaging 0.99
IGL01563:Slc16a14 APN 1 84912187 splice site probably benign
R0315:Slc16a14 UTSW 1 84912496 missense possibly damaging 0.46
R0380:Slc16a14 UTSW 1 84929530 missense possibly damaging 0.72
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1469:Slc16a14 UTSW 1 84929461 missense probably damaging 1.00
R1837:Slc16a14 UTSW 1 84912399 missense probably benign 0.02
R2149:Slc16a14 UTSW 1 84907399 missense probably damaging 1.00
R2293:Slc16a14 UTSW 1 84912843 missense probably benign
R3790:Slc16a14 UTSW 1 84929280 unclassified probably benign
R4016:Slc16a14 UTSW 1 84912507 nonsense probably null
R4596:Slc16a14 UTSW 1 84929357 missense probably damaging 1.00
R4723:Slc16a14 UTSW 1 84913020 missense probably damaging 1.00
R5137:Slc16a14 UTSW 1 84912597 missense probably damaging 1.00
R5262:Slc16a14 UTSW 1 84912891 missense probably benign 0.00
R5410:Slc16a14 UTSW 1 84907424 missense probably damaging 0.98
R5927:Slc16a14 UTSW 1 84912267 missense possibly damaging 0.91
R5968:Slc16a14 UTSW 1 84912505 missense possibly damaging 0.70
R6052:Slc16a14 UTSW 1 84912709 missense possibly damaging 0.75
R6264:Slc16a14 UTSW 1 84907409 missense probably benign 0.30
R6290:Slc16a14 UTSW 1 84907385 missense probably benign 0.10
R7383:Slc16a14 UTSW 1 84912571 missense probably damaging 1.00
R7390:Slc16a14 UTSW 1 84929466 missense probably benign 0.25
R7535:Slc16a14 UTSW 1 84913122 missense probably damaging 1.00
R8326:Slc16a14 UTSW 1 84912345 missense possibly damaging 0.94
R8669:Slc16a14 UTSW 1 84922884 missense probably benign 0.00
R8784:Slc16a14 UTSW 1 84913063 missense probably benign 0.01
R9409:Slc16a14 UTSW 1 84929395 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGTTCTAATCACGTCTGCCAC -3'
(R):5'- ATCAACTCTGGGTTCCACCG -3'

Sequencing Primer
(F):5'- TCTGCCACCTCTGCAGAGAG -3'
(R):5'- GTAGGGATACTCTTTTTGCTC -3'
Posted On 2015-10-08