Incidental Mutation 'R4637:4930548H24Rik'
ID350756
Institutional Source Beutler Lab
Gene Symbol 4930548H24Rik
Ensembl Gene ENSMUSG00000029138
Gene NameRIKEN cDNA 4930548H24 gene
Synonyms
MMRRC Submission 042010-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4637 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location31485740-31488476 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31488091 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 396 (R396Q)
Ref Sequence ENSEMBL: ENSMUSP00000031020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031020]
Predicted Effect probably benign
Transcript: ENSMUST00000031020
AA Change: R396Q

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000031020
Gene: ENSMUSG00000029138
AA Change: R396Q

DomainStartEndE-ValueType
coiled coil region 151 195 N/A INTRINSIC
Pfam:DUF4515 202 407 2e-77 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202441
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202605
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art1 T A 7: 102,106,337 V12E probably damaging Het
Ccdc180 A G 4: 45,914,443 S653G probably benign Het
Clic6 T C 16: 92,497,061 probably benign Het
Fras1 T A 5: 96,778,088 L3717Q probably damaging Het
Gpat3 C T 5: 100,857,173 P58L probably benign Het
Gtf2f1 G T 17: 57,004,534 P292H probably benign Het
Hcn1 A T 13: 117,975,713 T738S unknown Het
Hivep2 C A 10: 14,128,969 T437K probably benign Het
Hmbs A G 9: 44,339,537 S130P probably damaging Het
Kif1b A T 4: 149,199,311 I1299N probably damaging Het
Mrc2 G A 11: 105,348,431 probably null Het
Muc3 A T 5: 137,146,654 L56Q probably damaging Het
Myd88 G A 9: 119,338,109 probably null Het
Nol6 G A 4: 41,121,788 R249W probably damaging Het
Olfr1284 C T 2: 111,379,582 T194I probably benign Het
Pcdhb1 T C 18: 37,265,749 V251A possibly damaging Het
Prkcd A G 14: 30,598,765 S633P probably benign Het
Rarb T C 14: 16,574,875 H47R possibly damaging Het
Slc16a14 A G 1: 84,907,282 V512A possibly damaging Het
Slc34a3 C T 2: 25,229,461 V466M possibly damaging Het
Stat3 A G 11: 100,893,230 S623P probably damaging Het
Vmn2r16 T G 5: 109,330,414 S12A probably benign Het
Zfhx4 C G 3: 5,403,404 P2874R probably damaging Het
Zfp3 T C 11: 70,771,355 S47P probably benign Het
Zfp791 T C 8: 85,109,885 E450G possibly damaging Het
Other mutations in 4930548H24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01457:4930548H24Rik APN 5 31487427 missense probably benign 0.00
IGL02009:4930548H24Rik APN 5 31487491 missense probably benign 0.00
FR4304:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4340:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4342:4930548H24Rik UTSW 5 31487373 small deletion probably benign
FR4589:4930548H24Rik UTSW 5 31487373 small deletion probably benign
LCD18:4930548H24Rik UTSW 5 31487373 small deletion probably benign
PIT4486001:4930548H24Rik UTSW 5 31487743 missense probably damaging 0.99
R0650:4930548H24Rik UTSW 5 31485968 unclassified probably benign
R1366:4930548H24Rik UTSW 5 31487517 missense probably benign 0.07
R2050:4930548H24Rik UTSW 5 31486058 missense possibly damaging 0.68
R2070:4930548H24Rik UTSW 5 31487383 missense possibly damaging 0.91
R2862:4930548H24Rik UTSW 5 31485911 unclassified probably benign
R3965:4930548H24Rik UTSW 5 31487991 missense probably benign 0.02
R4299:4930548H24Rik UTSW 5 31487526 missense possibly damaging 0.82
R4634:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4635:4930548H24Rik UTSW 5 31488091 missense probably benign 0.01
R4887:4930548H24Rik UTSW 5 31486252 missense probably benign 0.19
R5587:4930548H24Rik UTSW 5 31486084 missense probably benign
R5897:4930548H24Rik UTSW 5 31485964 unclassified probably benign
R6181:4930548H24Rik UTSW 5 31488055 missense probably damaging 0.98
R6183:4930548H24Rik UTSW 5 31487976 missense probably damaging 0.99
RF006:4930548H24Rik UTSW 5 31487550 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCAGGCAGGAGACCATAAC -3'
(R):5'- GGGGCCTAGTAGTTCTGAATCTTC -3'

Sequencing Primer
(F):5'- GGAGACCATAACACCCCAGAGG -3'
(R):5'- GTAGTTCTGAATCTTCATTTTCTGGC -3'
Posted On2015-10-08