Incidental Mutation 'R0268:Hcn4'
ID35076
Institutional Source Beutler Lab
Gene Symbol Hcn4
Ensembl Gene ENSMUSG00000032338
Gene Namehyperpolarization-activated, cyclic nucleotide-gated K+ 4
Synonyms
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0268 (G1)
Quality Score161
Status Validated
Chromosome9
Chromosomal Location58823412-58863175 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 58860162 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Alanine at position 1002 (E1002A)
Ref Sequence ENSEMBL: ENSMUSP00000034889 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034889]
Predicted Effect unknown
Transcript: ENSMUST00000034889
AA Change: E1002A
SMART Domains Protein: ENSMUSP00000034889
Gene: ENSMUSG00000032338
AA Change: E1002A

DomainStartEndE-ValueType
low complexity region 27 39 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
low complexity region 97 120 N/A INTRINSIC
low complexity region 150 184 N/A INTRINSIC
Pfam:Ion_trans_N 218 261 1.2e-23 PFAM
Pfam:Ion_trans 262 525 2.2e-25 PFAM
low complexity region 526 537 N/A INTRINSIC
Blast:cNMP 538 570 9e-13 BLAST
cNMP 595 708 2.27e-23 SMART
low complexity region 761 771 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 808 818 N/A INTRINSIC
low complexity region 831 856 N/A INTRINSIC
low complexity region 866 906 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 931 956 N/A INTRINSIC
low complexity region 960 987 N/A INTRINSIC
low complexity region 991 1004 N/A INTRINSIC
low complexity region 1021 1036 N/A INTRINSIC
low complexity region 1045 1073 N/A INTRINSIC
low complexity region 1123 1140 N/A INTRINSIC
low complexity region 1154 1164 N/A INTRINSIC
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the hyperpolarization-activated cyclic nucleotide-gated potassium channels. The encoded protein shows slow kinetics of activation and inactivation, and is necessary for the cardiac pacemaking process. This channel may also mediate responses to sour stimuli. Mutations in this gene have been linked to sick sinus syndrome 2, also known as atrial fibrillation with bradyarrhythmia or familial sinus bradycardia. Two pseudogenes have been identified on chromosome 15. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience embryonic lethality between E9.5 and E11.5. Conditional deletion in cardiac tissue results in severe bradycardia and death. Mice over-expressing the gene exhibit impaired firing rate in ORN, small olfactory bulb and reduced glomeruli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gls GGCTGCTGCTGCTGCTGCTGCTGCTGCTG GGCTGCTGCTGCTGCTGCTGCTGCTG 1: 52,232,694 probably benign Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trim65 T A 11: 116,126,644 probably benign Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Hcn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Hcn4 APN 9 58860053 missense unknown
IGL00939:Hcn4 APN 9 58843927 missense probably benign 0.39
IGL01154:Hcn4 APN 9 58859079 missense unknown
IGL01408:Hcn4 APN 9 58859886 missense unknown
IGL02658:Hcn4 APN 9 58859465 missense unknown
IGL02877:Hcn4 APN 9 58859167 missense unknown
IGL03211:Hcn4 APN 9 58858151 missense unknown
PIT1430001:Hcn4 UTSW 9 58859550 missense unknown
R0049:Hcn4 UTSW 9 58860299 missense probably damaging 0.98
R0812:Hcn4 UTSW 9 58823512 start codon destroyed probably null
R2121:Hcn4 UTSW 9 58824058 missense unknown
R3035:Hcn4 UTSW 9 58823680 missense unknown
R3715:Hcn4 UTSW 9 58844036 missense unknown
R3737:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R3958:Hcn4 UTSW 9 58844048 missense unknown
R4035:Hcn4 UTSW 9 58843889 missense probably benign 0.39
R4393:Hcn4 UTSW 9 58844300 missense unknown
R4418:Hcn4 UTSW 9 58843895 missense probably benign 0.39
R4532:Hcn4 UTSW 9 58857798 missense unknown
R4765:Hcn4 UTSW 9 58857977 missense unknown
R4857:Hcn4 UTSW 9 58859570 missense unknown
R4967:Hcn4 UTSW 9 58859828 missense unknown
R5068:Hcn4 UTSW 9 58860021 missense unknown
R5253:Hcn4 UTSW 9 58824275 missense unknown
R5304:Hcn4 UTSW 9 58843932 missense probably benign 0.39
R5600:Hcn4 UTSW 9 58859293 splice site probably null
R6346:Hcn4 UTSW 9 58859044 missense unknown
R6575:Hcn4 UTSW 9 58824152 missense unknown
R6622:Hcn4 UTSW 9 58857727 missense unknown
R6967:Hcn4 UTSW 9 58823945 missense unknown
R7038:Hcn4 UTSW 9 58823584 missense unknown
R7054:Hcn4 UTSW 9 58855717 missense unknown
R7229:Hcn4 UTSW 9 58853399 missense unknown
R7407:Hcn4 UTSW 9 58859370 missense unknown
R7448:Hcn4 UTSW 9 58844299 missense unknown
R7531:Hcn4 UTSW 9 58860137 missense unknown
R7572:Hcn4 UTSW 9 58823780 missense unknown
R7680:Hcn4 UTSW 9 58860671 missense probably benign 0.08
RF011:Hcn4 UTSW 9 58859915 missense unknown
X0009:Hcn4 UTSW 9 58860759 nonsense probably null
X0057:Hcn4 UTSW 9 58859368 missense unknown
Predicted Primers PCR Primer
(F):5'- GGATTCTCTGCACCTCCTGGATTG -3'
(R):5'- AGAGGCTGAGATGAGCTTCAGGTC -3'

Sequencing Primer
(F):5'- GGTTCGGCCACTTTCACAAG -3'
(R):5'- AGATGAGCTTCAGGTCCTGTG -3'
Posted On2013-05-09