Incidental Mutation 'R4637:Rarb'
ID 350771
Institutional Source Beutler Lab
Gene Symbol Rarb
Ensembl Gene ENSMUSG00000017491
Gene Name retinoic acid receptor, beta
Synonyms RARbeta2, RAR beta 2, Hap
MMRRC Submission 042010-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4637 (G1)
Quality Score 225
Status Validated
Chromosome 14
Chromosomal Location 5650540-6038924 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 16574875 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 47 (H47R)
Ref Sequence ENSEMBL: ENSMUSP00000153178 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063750] [ENSMUST00000223576] [ENSMUST00000223976] [ENSMUST00000225245] [ENSMUST00000225594] [ENSMUST00000225921]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000063750
AA Change: H47R

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000067694
Gene: ENSMUSG00000017491
AA Change: H47R

DomainStartEndE-ValueType
low complexity region 52 75 N/A INTRINSIC
ZnF_C4 78 149 3.77e-40 SMART
HOLI 223 381 1.72e-34 SMART
low complexity region 428 445 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223576
Predicted Effect probably benign
Transcript: ENSMUST00000223976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224418
Predicted Effect probably benign
Transcript: ENSMUST00000225245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225356
Predicted Effect possibly damaging
Transcript: ENSMUST00000225594
AA Change: H47R

PolyPhen 2 Score 0.507 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000225921
AA Change: H47R

PolyPhen 2 Score 0.133 (Sensitivity: 0.92; Specificity: 0.86)
Meta Mutation Damage Score 0.0678 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced growth, but are otherwise normal. Rarb/Rara double knockouts exhibit impaired vitamin A signaling and develop urogenital malformations, including renal hypoplasia and hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art1 T A 7: 101,755,544 (GRCm39) V12E probably damaging Het
Ccdc121 G A 5: 31,645,435 (GRCm39) R396Q probably benign Het
Ccdc180 A G 4: 45,914,443 (GRCm39) S653G probably benign Het
Clic6 T C 16: 92,293,949 (GRCm39) probably benign Het
Fras1 T A 5: 96,925,947 (GRCm39) L3717Q probably damaging Het
Gpat3 C T 5: 101,005,039 (GRCm39) P58L probably benign Het
Gtf2f1 G T 17: 57,311,534 (GRCm39) P292H probably benign Het
Hcn1 A T 13: 118,112,249 (GRCm39) T738S unknown Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Hmbs A G 9: 44,250,834 (GRCm39) S130P probably damaging Het
Kif1b A T 4: 149,283,768 (GRCm39) I1299N probably damaging Het
Mrc2 G A 11: 105,239,257 (GRCm39) probably null Het
Muc17 A T 5: 137,175,502 (GRCm39) L56Q probably damaging Het
Myd88 G A 9: 119,167,175 (GRCm39) probably null Het
Nol6 G A 4: 41,121,788 (GRCm39) R249W probably damaging Het
Or4g17 C T 2: 111,209,927 (GRCm39) T194I probably benign Het
Pcdhb1 T C 18: 37,398,802 (GRCm39) V251A possibly damaging Het
Prkcd A G 14: 30,320,722 (GRCm39) S633P probably benign Het
Slc16a14 A G 1: 84,885,003 (GRCm39) V512A possibly damaging Het
Slc34a3 C T 2: 25,119,473 (GRCm39) V466M possibly damaging Het
Stat3 A G 11: 100,784,056 (GRCm39) S623P probably damaging Het
Vmn2r16 T G 5: 109,478,280 (GRCm39) S12A probably benign Het
Zfhx4 C G 3: 5,468,464 (GRCm39) P2874R probably damaging Het
Zfp3 T C 11: 70,662,181 (GRCm39) S47P probably benign Het
Zfp791 T C 8: 85,836,514 (GRCm39) E450G possibly damaging Het
Other mutations in Rarb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:Rarb APN 14 16,443,791 (GRCm38) nonsense probably null
IGL01483:Rarb APN 14 16,432,273 (GRCm38) splice site probably benign
IGL01591:Rarb APN 14 16,434,207 (GRCm38) missense possibly damaging 0.93
IGL01769:Rarb APN 14 16,443,760 (GRCm38) missense probably damaging 0.97
IGL01782:Rarb APN 14 16,434,180 (GRCm38) missense probably damaging 1.00
IGL01866:Rarb APN 14 16,443,751 (GRCm38) missense probably benign 0.17
IGL03299:Rarb APN 14 16,434,168 (GRCm38) missense probably damaging 1.00
IGL03134:Rarb UTSW 14 16,436,910 (GRCm38) missense probably damaging 0.99
R0055:Rarb UTSW 14 16,509,066 (GRCm38) missense probably damaging 1.00
R0055:Rarb UTSW 14 16,509,066 (GRCm38) missense probably damaging 1.00
R0849:Rarb UTSW 14 16,434,293 (GRCm38) missense probably damaging 1.00
R1067:Rarb UTSW 14 16,436,769 (GRCm38) missense probably damaging 0.98
R1314:Rarb UTSW 14 16,508,932 (GRCm38) critical splice donor site probably null
R1416:Rarb UTSW 14 16,435,177 (GRCm38) missense possibly damaging 0.82
R2894:Rarb UTSW 14 16,435,146 (GRCm38) missense probably damaging 1.00
R4950:Rarb UTSW 14 16,432,085 (GRCm38) unclassified probably benign
R5420:Rarb UTSW 14 16,434,249 (GRCm38) missense possibly damaging 0.89
R5456:Rarb UTSW 14 16,436,843 (GRCm38) missense probably damaging 1.00
R5635:Rarb UTSW 14 16,443,788 (GRCm38) missense probably damaging 1.00
R5689:Rarb UTSW 14 16,434,177 (GRCm38) missense probably damaging 1.00
R5708:Rarb UTSW 14 16,548,545 (GRCm38) missense probably damaging 0.99
R5819:Rarb UTSW 14 16,443,820 (GRCm38) missense possibly damaging 0.68
R5935:Rarb UTSW 14 16,434,264 (GRCm38) missense probably damaging 1.00
R6264:Rarb UTSW 14 16,818,819 (GRCm38) missense probably benign 0.31
R6823:Rarb UTSW 14 16,443,824 (GRCm38) missense probably damaging 1.00
R6975:Rarb UTSW 14 16,574,942 (GRCm38) missense possibly damaging 0.92
R7295:Rarb UTSW 14 16,508,932 (GRCm38) critical splice donor site probably null
R7402:Rarb UTSW 14 16,548,419 (GRCm38) missense probably damaging 1.00
R7849:Rarb UTSW 14 16,548,473 (GRCm38) missense probably damaging 1.00
R8471:Rarb UTSW 14 16,548,456 (GRCm38) unclassified probably benign
R8833:Rarb UTSW 14 16,819,015 (GRCm38) unclassified probably benign
R8835:Rarb UTSW 14 16,575,011 (GRCm38) missense probably benign 0.23
R8896:Rarb UTSW 14 16,436,804 (GRCm38) missense probably damaging 1.00
R9011:Rarb UTSW 14 16,435,140 (GRCm38) missense probably damaging 0.98
R9090:Rarb UTSW 14 16,435,235 (GRCm38) nonsense probably null
R9184:Rarb UTSW 14 16,818,882 (GRCm38) start gained probably benign
R9184:Rarb UTSW 14 16,818,881 (GRCm38) start gained probably benign
R9271:Rarb UTSW 14 16,435,235 (GRCm38) nonsense probably null
R9574:Rarb UTSW 14 16,574,858 (GRCm38) missense probably damaging 0.96
X0065:Rarb UTSW 14 16,434,303 (GRCm38) missense possibly damaging 0.89
Z1177:Rarb UTSW 14 16,818,725 (GRCm38) missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TGCATGGCAGCCTATCACAC -3'
(R):5'- AATTCATGATTCGGGGCTGG -3'

Sequencing Primer
(F):5'- GGCAGCCTATCACACCCCTTC -3'
(R):5'- CACCTAGAGGATAAGCACTTTTGCAG -3'
Posted On 2015-10-08