Incidental Mutation 'R4638:Slc11a1'
ID350775
Institutional Source Beutler Lab
Gene Symbol Slc11a1
Ensembl Gene ENSMUSG00000026177
Gene Namesolute carrier family 11 (proton-coupled divalent metal ion transporters), member 1
Synonymshost resistance locus Bcg/Ity/Lsh, Nramp, ity, Lsh, Ity, Bcg, Nramp1
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74375195-74386062 bp(+) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 74375278 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027368] [ENSMUST00000187516]
Predicted Effect probably benign
Transcript: ENSMUST00000027368
SMART Domains Protein: ENSMUSP00000027368
Gene: ENSMUSG00000026177

DomainStartEndE-ValueType
Pfam:Nramp 75 460 1.5e-119 PFAM
transmembrane domain 464 486 N/A INTRINSIC
transmembrane domain 491 513 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131511
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135137
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147233
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155865
Predicted Effect probably benign
Transcript: ENSMUST00000187516
SMART Domains Protein: ENSMUSP00000139455
Gene: ENSMUSG00000026177

DomainStartEndE-ValueType
Pfam:Nramp 46 419 1.4e-109 PFAM
transmembrane domain 423 445 N/A INTRINSIC
transmembrane domain 450 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 11 (proton-coupled divalent metal ion transporters) family and encodes a multi-pass membrane protein. The protein functions as a divalent transition metal (iron and manganese) transporter involved in iron metabolism and host resistance to certain pathogens. Mutations in this gene have been associated with susceptibility to infectious diseases such as tuberculosis and leprosy, and inflammatory diseases such as rheumatoid arthritis and Crohn disease. Alternatively spliced variants that encode different protein isoforms have been described but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene are associated with susceptibility to infection with pathogens, including Myobacterium, Salmonella and Leishmania. Depending on the mutation, mutants may exhibit either increased or decreased susceptibility to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Slc11a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Slc11a1 APN 1 74381898 splice site probably null
IGL00813:Slc11a1 APN 1 74383480 missense probably benign 0.03
IGL00970:Slc11a1 APN 1 74380662 missense probably damaging 1.00
IGL01017:Slc11a1 APN 1 74379796 missense probably damaging 1.00
IGL01646:Slc11a1 APN 1 74384740 missense probably damaging 0.99
IGL01941:Slc11a1 APN 1 74377179 missense probably damaging 1.00
IGL01996:Slc11a1 APN 1 74376806 missense possibly damaging 0.93
IGL02580:Slc11a1 APN 1 74380259 missense probably damaging 0.99
IGL02586:Slc11a1 APN 1 74385132 splice site probably benign
IGL02961:Slc11a1 APN 1 74377173 missense probably damaging 1.00
R1813:Slc11a1 UTSW 1 74375772 missense probably benign
R1896:Slc11a1 UTSW 1 74375772 missense probably benign
R2219:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2220:Slc11a1 UTSW 1 74380665 missense probably damaging 0.98
R2416:Slc11a1 UTSW 1 74383644 missense probably damaging 0.96
R2432:Slc11a1 UTSW 1 74383751 splice site probably benign
R3893:Slc11a1 UTSW 1 74384706 missense probably damaging 1.00
R4450:Slc11a1 UTSW 1 74385535 utr 3 prime probably benign
R4782:Slc11a1 UTSW 1 74384088 missense probably damaging 0.98
R5068:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5069:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5070:Slc11a1 UTSW 1 74385184 missense probably damaging 1.00
R5215:Slc11a1 UTSW 1 74383777 intron probably benign
R5333:Slc11a1 UTSW 1 74384145 missense probably damaging 1.00
R5613:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5621:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5622:Slc11a1 UTSW 1 74380906 missense probably damaging 1.00
R5950:Slc11a1 UTSW 1 74377176 missense probably benign 0.40
R6239:Slc11a1 UTSW 1 74384115 missense possibly damaging 0.82
R6776:Slc11a1 UTSW 1 74384085 missense probably damaging 1.00
R7199:Slc11a1 UTSW 1 74383671 missense possibly damaging 0.83
R7356:Slc11a1 UTSW 1 74385489 missense probably benign
R8142:Slc11a1 UTSW 1 74385259 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAACTGGTCACTTCTGCC -3'
(R):5'- ATTTGTGAGACAGGAGGCCC -3'

Sequencing Primer
(F):5'- AACTGGTCACTTCTGCCTTTGG -3'
(R):5'- CACCAGGTTTAATCCACAGAAGTG -3'
Posted On2015-10-08