Incidental Mutation 'R4638:Tmem198'
ID350776
Institutional Source Beutler Lab
Gene Symbol Tmem198
Ensembl Gene ENSMUSG00000051703
Gene Nametransmembrane protein 198
SynonymsTmem198-1, A230078I05Rik, Tmem198a
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4638 (G1)
Quality Score175
Status Validated
Chromosome1
Chromosomal Location75479532-75485705 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 75479707 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 2 (G2*)
Ref Sequence ENSEMBL: ENSMUSP00000140795 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050899] [ENSMUST00000079205] [ENSMUST00000094818] [ENSMUST00000113575] [ENSMUST00000124042] [ENSMUST00000138683] [ENSMUST00000148980] [ENSMUST00000187411]
Predicted Effect probably benign
Transcript: ENSMUST00000050899
SMART Domains Protein: ENSMUSP00000057865
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 40 236 7.2e-51 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000079205
SMART Domains Protein: ENSMUSP00000078199
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Pfam:CHGN 262 761 5e-150 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000094818
SMART Domains Protein: ENSMUSP00000092412
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
Pfam:CHGN 100 599 3.3e-174 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000113575
SMART Domains Protein: ENSMUSP00000109205
Gene: ENSMUSG00000051703

DomainStartEndE-ValueType
Pfam:DUF4203 39 237 2.2e-59 PFAM
low complexity region 252 302 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124042
SMART Domains Protein: ENSMUSP00000122057
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138683
SMART Domains Protein: ENSMUSP00000117253
Gene: ENSMUSG00000032997

DomainStartEndE-ValueType
low complexity region 37 46 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143496
Predicted Effect probably benign
Transcript: ENSMUST00000148980
AA Change: R32L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000116977
Gene: ENSMUSG00000051703
AA Change: R32L

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Pfam:DUF4203 119 150 6.6e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156499
Predicted Effect probably null
Transcript: ENSMUST00000187411
AA Change: G2*
SMART Domains Protein: ENSMUSP00000140795
Gene: ENSMUSG00000051703
AA Change: G2*

DomainStartEndE-ValueType
low complexity region 38 50 N/A INTRINSIC
Pfam:DUF4203 101 142 6.9e-10 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Tmem198
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Tmem198 APN 1 75484370 unclassified probably benign
IGL03033:Tmem198 APN 1 75482968 missense possibly damaging 0.92
R1165:Tmem198 UTSW 1 75479932 intron probably benign
R1876:Tmem198 UTSW 1 75484923 missense probably damaging 1.00
R5320:Tmem198 UTSW 1 75479856 missense probably benign
R6369:Tmem198 UTSW 1 75479743 missense probably benign 0.00
R6601:Tmem198 UTSW 1 75480373 missense possibly damaging 0.71
R7455:Tmem198 UTSW 1 75479786 missense unknown
R8027:Tmem198 UTSW 1 75480062 intron probably benign
R8163:Tmem198 UTSW 1 75483027 missense possibly damaging 0.63
R8502:Tmem198 UTSW 1 75482709 missense probably damaging 1.00
Z1088:Tmem198 UTSW 1 75480262 missense probably benign 0.18
Predicted Primers PCR Primer
(F):5'- GATGACGTCAGAAGCAGCC -3'
(R):5'- AATTGTCCAAGATCTACCTGGG -3'

Sequencing Primer
(F):5'- CCTGCCAGGATGGTGCAC -3'
(R):5'- AAGATCTACCTGGGCCGGAG -3'
Posted On2015-10-08