Incidental Mutation 'R4638:Tmem81'
ID350777
Institutional Source Beutler Lab
Gene Symbol Tmem81
Ensembl Gene ENSMUSG00000048174
Gene Nametransmembrane protein 81
Synonyms4930429O20Rik
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location132506230-132508639 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 132508205 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027700] [ENSMUST00000058167] [ENSMUST00000086521] [ENSMUST00000187505] [ENSMUST00000188789] [ENSMUST00000190825] [ENSMUST00000190997]
Predicted Effect probably benign
Transcript: ENSMUST00000027700
SMART Domains Protein: ENSMUSP00000027700
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000058167
AA Change: T250A
SMART Domains Protein: ENSMUSP00000062565
Gene: ENSMUSG00000048174
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086521
SMART Domains Protein: ENSMUSP00000083707
Gene: ENSMUSG00000053024

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IGc2 54 120 8.78e-9 SMART
IG 142 232 3.89e-1 SMART
IGc2 254 315 2.14e-21 SMART
IGc2 341 404 4.59e-12 SMART
IGc2 433 497 7.52e-8 SMART
IGc2 523 596 2.72e-5 SMART
FN3 610 696 2.72e-12 SMART
FN3 713 799 1.02e-2 SMART
FN3 815 899 5.27e-10 SMART
FN3 915 995 8.91e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186487
Predicted Effect probably benign
Transcript: ENSMUST00000187505
SMART Domains Protein: ENSMUSP00000141176
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
Blast:WD40 1 52 9e-13 BLAST
WD40 55 99 5.1e-3 SMART
WD40 114 153 7.9e-2 SMART
WD40 156 195 1.9e-2 SMART
low complexity region 217 231 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187834
Predicted Effect probably benign
Transcript: ENSMUST00000188065
Predicted Effect unknown
Transcript: ENSMUST00000188789
AA Change: T250A
SMART Domains Protein: ENSMUSP00000139911
Gene: ENSMUSG00000048174
AA Change: T250A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Blast:IG 86 178 6e-54 BLAST
transmembrane domain 221 243 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190601
Predicted Effect probably benign
Transcript: ENSMUST00000190825
SMART Domains Protein: ENSMUSP00000139519
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 1.4e-3 SMART
WD40 55 94 4.6e-9 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 5.1e-3 SMART
WD40 241 280 7.9e-2 SMART
WD40 283 322 1.9e-2 SMART
low complexity region 344 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000190997
SMART Domains Protein: ENSMUSP00000141003
Gene: ENSMUSG00000026439

DomainStartEndE-ValueType
WD40 14 52 2.31e-1 SMART
WD40 55 94 7.33e-7 SMART
Blast:WD40 97 177 2e-31 BLAST
WD40 182 226 8.29e-1 SMART
WD40 241 280 1.28e1 SMART
WD40 283 322 2.97e0 SMART
low complexity region 344 358 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Tmem81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01918:Tmem81 APN 1 132507960 missense probably damaging 1.00
R0094:Tmem81 UTSW 1 132508049 missense probably benign 0.00
R0255:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0432:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0531:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0532:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0551:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0614:Tmem81 UTSW 1 132507731 missense probably benign 0.01
R0651:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0696:Tmem81 UTSW 1 132507829 missense probably damaging 1.00
R0973:Tmem81 UTSW 1 132507924 missense probably damaging 1.00
R1663:Tmem81 UTSW 1 132507897 missense probably benign 0.05
R1750:Tmem81 UTSW 1 132507583 missense probably damaging 0.98
R1881:Tmem81 UTSW 1 132508210 unclassified probably benign
R2074:Tmem81 UTSW 1 132507906 missense probably damaging 0.98
R2121:Tmem81 UTSW 1 132508109 missense probably benign 0.00
R3003:Tmem81 UTSW 1 132508014 missense probably benign 0.38
R3789:Tmem81 UTSW 1 132508071 missense probably benign 0.03
R7162:Tmem81 UTSW 1 132507617 missense probably damaging 1.00
R7375:Tmem81 UTSW 1 132507563 missense possibly damaging 0.76
R7527:Tmem81 UTSW 1 132508146 missense probably benign 0.34
R7586:Tmem81 UTSW 1 132507773 missense probably damaging 0.99
Z1176:Tmem81 UTSW 1 132508211 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGTCCTTCCTCCAAAGTTG -3'
(R):5'- GATGCTGCCCTGAACTACTGAG -3'

Sequencing Primer
(F):5'- TGGTAAACCTAAATTTCCAACAGTCC -3'
(R):5'- GCCCTGAACTACTGAGGTTAC -3'
Posted On2015-10-08