Incidental Mutation 'R4638:Nek7'
ID350778
Institutional Source Beutler Lab
Gene Symbol Nek7
Ensembl Gene ENSMUSG00000026393
Gene NameNIMA (never in mitosis gene a)-related expressed kinase 7
Synonyms2810460C19Rik
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location138482875-138620141 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 138544300 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 34 (F34Y)
Ref Sequence ENSEMBL: ENSMUSP00000140635 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027642] [ENSMUST00000186017] [ENSMUST00000187407]
Predicted Effect probably benign
Transcript: ENSMUST00000027642
AA Change: F34Y

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027642
Gene: ENSMUSG00000026393
AA Change: F34Y

DomainStartEndE-ValueType
S_TKc 34 299 1.86e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186017
AA Change: F34Y

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140903
Gene: ENSMUSG00000026393
AA Change: F34Y

DomainStartEndE-ValueType
S_TKc 34 299 1.86e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187407
AA Change: F34Y

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140635
Gene: ENSMUSG00000026393
AA Change: F34Y

DomainStartEndE-ValueType
S_TKc 34 299 1.86e-91 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191549
Meta Mutation Damage Score 0.0870 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NIMA-related kinases share high amino acid sequence identity with the gene product of the Aspergillus nidulans 'never in mitosis A' gene, which controls initiation of mitosis.[supplied by OMIM, Jul 2002]
PHENOTYPE: Mice homozygous for an ENU-induced allele exhibit infertility, decreased susceptibility to EAE, decreased body weight, abnormal gait, slight parasis and abnormal immune system response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Nek7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02151:Nek7 APN 1 138487100 missense probably damaging 1.00
Beauties UTSW 1 138534389 missense probably damaging 1.00
Cuties UTSW 1 138544242 nonsense probably null
Doubletake UTSW 1 138515654 missense probably damaging 1.00
R0010:Nek7 UTSW 1 138544204 missense possibly damaging 0.60
R0103:Nek7 UTSW 1 138544242 nonsense probably null
R0103:Nek7 UTSW 1 138544242 nonsense probably null
R0646:Nek7 UTSW 1 138515693 frame shift probably null
R3953:Nek7 UTSW 1 138534389 missense probably damaging 1.00
R3955:Nek7 UTSW 1 138534389 missense probably damaging 1.00
R3957:Nek7 UTSW 1 138534389 missense probably damaging 1.00
R4750:Nek7 UTSW 1 138498673 missense probably damaging 1.00
R5101:Nek7 UTSW 1 138515693 missense probably benign 0.04
R5331:Nek7 UTSW 1 138498574 critical splice donor site probably null
R5838:Nek7 UTSW 1 138534363 critical splice donor site probably null
R6083:Nek7 UTSW 1 138515654 missense probably damaging 1.00
R6302:Nek7 UTSW 1 138498613 missense probably damaging 0.99
R6855:Nek7 UTSW 1 138515682 missense probably damaging 1.00
R6857:Nek7 UTSW 1 138515682 missense probably damaging 1.00
R6941:Nek7 UTSW 1 138502638 missense probably damaging 0.97
R7140:Nek7 UTSW 1 138487055 missense probably benign 0.01
R7808:Nek7 UTSW 1 138561771 start gained probably benign
Z1088:Nek7 UTSW 1 138515625 missense probably null 0.81
Predicted Primers PCR Primer
(F):5'- TGGAAAACTTAGTTTCCACCCC -3'
(R):5'- GGAACTCAAATATCTTTGGTGTGGG -3'

Sequencing Primer
(F):5'- GTTTCATGACCCAAATCATTCCAG -3'
(R):5'- GATGTTTGCAACTTTACTGTAGGC -3'
Posted On2015-10-08