Incidental Mutation 'R4638:Olfr1126'
ID350784
Institutional Source Beutler Lab
Gene Symbol Olfr1126
Ensembl Gene ENSMUSG00000058194
Gene Nameolfactory receptor 1126
SynonymsGA_x6K02T2Q125-48959068-48960012, MOR264-5
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87453962-87458911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87457983 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 273 (S273P)
Ref Sequence ENSEMBL: ENSMUSP00000150504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071355] [ENSMUST00000213366]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071355
AA Change: S273P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000071313
Gene: ENSMUSG00000058194
AA Change: S273P

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 8.6e-52 PFAM
Pfam:7tm_1 47 296 8.9e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213366
AA Change: S273P

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Olfr1126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1126 APN 2 87457927 missense probably damaging 1.00
IGL01875:Olfr1126 APN 2 87457310 missense probably damaging 0.99
IGL02207:Olfr1126 APN 2 87457450 missense probably benign 0.22
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0478:Olfr1126 UTSW 2 87458026 missense probably damaging 0.99
R1055:Olfr1126 UTSW 2 87457437 small deletion probably benign
R1438:Olfr1126 UTSW 2 87457992 missense probably benign 0.00
R1625:Olfr1126 UTSW 2 87457672 missense probably damaging 1.00
R1912:Olfr1126 UTSW 2 87457383 missense probably damaging 1.00
R3052:Olfr1126 UTSW 2 87457903 missense probably damaging 1.00
R5102:Olfr1126 UTSW 2 87457794 missense probably benign
R5526:Olfr1126 UTSW 2 87457765 missense probably benign 0.01
R5825:Olfr1126 UTSW 2 87457450 missense probably benign 0.22
R5965:Olfr1126 UTSW 2 87458037 missense probably benign 0.14
R6505:Olfr1126 UTSW 2 87457927 missense probably damaging 1.00
R7494:Olfr1126 UTSW 2 87457568 missense probably damaging 0.99
R8081:Olfr1126 UTSW 2 87457169 start codon destroyed probably null 0.63
Predicted Primers PCR Primer
(F):5'- TACACGAGTTGTCTGTCTACTTAG -3'
(R):5'- TTGTTCAGTAGCTGAGTAAGAAGC -3'

Sequencing Primer
(F):5'- TGTCTGTCTACTTAGTAGCTATGC -3'
(R):5'- GTAGCTGAGTAAGAAGCAATCAATC -3'
Posted On2015-10-08