Mutagenetix > Incidental Mutations

Incidental Mutation 'R4638:Gm10801'

350785

Institutional Source

Beutler Lab

Gene Symbol

Gm10801

Ensembl Gene

ENSMUSG00000075015

Gene Name

predicted gene 10801

Synonyms

MMRRC Submission

041900-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.495) question?

Stock #

R4638 (G1)

Quality Score

Status

Not validated

Chromosome

Chromosomal Location

98662237-98664083 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 98664007 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Threonine at position 143 (R143T)

Ref Sequence

ENSEMBL: ENSMUSP00000097276 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]

Predicted Effect

probably benign
Transcript: ENSMUST00000099683

SMART Domains

Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

Domain	Start	End	E-Value	Type
internal_repeat_1	1	41	1.13e-5	PROSPERO
internal_repeat_2	26	49	4.11e-5	PROSPERO
transmembrane domain	78	96	N/A	INTRINSIC
internal_repeat_1	114	174	1.13e-5	PROSPERO
low complexity region	177	188	N/A	INTRINSIC
internal_repeat_2	197	219	4.11e-5	PROSPERO

Predicted Effect

possibly damaging
Transcript: ENSMUST00000099684
AA Change: R143T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015
AA Change: R143T

Domain	Start	End	E-Value	Type
internal_repeat_1	2	73	1.19e-13	PROSPERO
internal_repeat_1	80	167	1.19e-13	PROSPERO

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

91% (40/44)

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcg8	A	G	17: 84,691,941	D155G	probably damaging	Het
Ano4	C	T	10: 88,954,697	A847T	probably damaging	Het
B4galt7	T	C	13: 55,600,146		probably benign	Het
Camk1g	T	A	1: 193,356,359	D85V	probably damaging	Het
Caskin1	G	A	17: 24,506,628	S1296N	probably benign	Het
Cebpa	A	G	7: 35,120,262	N282D	probably damaging	Het
Cngb1	G	A	8: 95,266,019	T196M	probably damaging	Het
Cobll1	T	C	2: 65,099,237	M619V	probably benign	Het
Coro7	A	T	16: 4,632,287	I566N	probably damaging	Het
Dpyd	A	T	3: 119,266,077	S808C	probably benign	Het
Fbn2	A	G	18: 58,010,304	V2893A	probably benign	Het
Krba1	T	A	6: 48,409,751	L441*	probably null	Het
Lama5	T	C	2: 180,190,413	T1712A	possibly damaging	Het
Lnpep	G	A	17: 17,575,307	T314I	probably damaging	Het
Lyst	T	C	13: 13,696,794		probably null	Het
Naa16	C	A	14: 79,340,033		probably null	Het
Nek7	A	T	1: 138,544,300	F34Y	probably benign	Het
Olfr1126	T	C	2: 87,457,983	S273P	possibly damaging	Het
Olfr699	A	T	7: 106,790,998	M1K	probably null	Het
Park7	G	A	4: 150,907,099	Q45*	probably null	Het
Pclo	C	A	5: 14,680,433	S2983*	probably null	Het
Pth1r	A	G	9: 110,727,073	L244P	possibly damaging	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
Slc11a1	G	A	1: 74,375,278		probably benign	Het
Slc12a8	T	G	16: 33,590,323	S200A	possibly damaging	Het
Slc7a10	A	G	7: 35,197,930	E262G	probably damaging	Het
Smg1	T	C	7: 118,195,926		probably benign	Het
Snapc4	A	G	2: 26,365,302	L1070P	probably damaging	Het
Sp2	A	G	11: 96,957,474	I435T	possibly damaging	Het
Srp72	A	G	5: 76,990,295	E309G	probably benign	Het
Sympk	G	T	7: 19,043,460	R545L	possibly damaging	Het
Tie1	C	T	4: 118,483,842	R314H	probably benign	Het
Tmem198	G	T	1: 75,479,707	G2*	probably null	Het
Tmem81	A	G	1: 132,508,205		probably benign	Het
Ttn	A	T	2: 76,822,477	V10938E	possibly damaging	Het
Zfp773	T	A	7: 7,135,336	Y100F	probably damaging	Het

Other mutations in Gm10801

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01100:Gm10801	APN	2	98663983	missense	probably benign
IGL01154:Gm10801	APN	2	98663983	missense	probably benign
PIT4131001:Gm10801	UTSW	2	98662303	missense	probably benign
PIT4142001:Gm10801	UTSW	2	98662303	missense	probably benign
R0026:Gm10801	UTSW	2	98663909	splice site	probably benign
R0063:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R0334:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R0335:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R1172:Gm10801	UTSW	2	98663907	splice site	probably benign
R1321:Gm10801	UTSW	2	98663907	splice site	probably benign
R1871:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R1924:Gm10801	UTSW	2	98663852	missense	probably damaging	1.00
R2163:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R2306:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R2379:Gm10801	UTSW	2	98663840	missense	probably benign	0.30
R3078:Gm10801	UTSW	2	98663852	missense	probably damaging	1.00
R3605:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R3892:Gm10801	UTSW	2	98663901	splice site	probably null
R3930:Gm10801	UTSW	2	98664016	missense	possibly damaging	0.48
R4709:Gm10801	UTSW	2	98663901	splice site	probably null
R5390:Gm10801	UTSW	2	98663806	small insertion	probably benign
R5405:Gm10801	UTSW	2	98663806	small insertion	probably benign
R5535:Gm10801	UTSW	2	98662499	frame shift	probably null
R5653:Gm10801	UTSW	2	98664051	missense	probably damaging	1.00
R5747:Gm10801	UTSW	2	98664007	missense	possibly damaging	0.66
R5987:Gm10801	UTSW	2	98663807	nonsense	probably null
R6086:Gm10801	UTSW	2	98663803	nonsense	probably null
R6090:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6093:Gm10801	UTSW	2	98663807	nonsense	probably null
R6112:Gm10801	UTSW	2	98664064	missense	probably benign	0.00
R6184:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6352:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6357:Gm10801	UTSW	2	98663807	frame shift	probably null
R6395:Gm10801	UTSW	2	98663807	small insertion	probably benign
R6514:Gm10801	UTSW	2	98663869	missense	probably benign	0.19
R6547:Gm10801	UTSW	2	98663803	nonsense	probably null
R6560:Gm10801	UTSW	2	98663807	nonsense	probably null
R6640:Gm10801	UTSW	2	98663807	nonsense	probably null
R6675:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6679:Gm10801	UTSW	2	98663806	small insertion	probably benign
R6684:Gm10801	UTSW	2	98663807	nonsense	probably null
R6758:Gm10801	UTSW	2	98663807	nonsense	probably null
R6786:Gm10801	UTSW	2	98663803	nonsense	probably null
R6886:Gm10801	UTSW	2	98663806	small insertion	probably benign
R7783:Gm10801	UTSW	2	98663807	nonsense	probably null
R7823:Gm10801	UTSW	2	98663807	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GCCCATCTGTGTAGAAAGCTG -3'
(R):5'- GTCTACTAAGGAGGCCACAAAC -3'

Sequencing Primer
(F):5'- CCAGGTCTTACAGTGTGCAC -3'
(R):5'- TCTACTAAGGAGGCCACAAACAACTG -3'

Posted On

2015-10-08