Incidental Mutation 'R4638:Gm10801'
ID350785
Institutional Source Beutler Lab
Gene Symbol Gm10801
Ensembl Gene ENSMUSG00000075015
Gene Namepredicted gene 10801
Synonyms
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.495) question?
Stock #R4638 (G1)
Quality Score81
Status Not validated
Chromosome2
Chromosomal Location98662237-98664083 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 98664007 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Threonine at position 143 (R143T)
Ref Sequence ENSEMBL: ENSMUSP00000097276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099683] [ENSMUST00000099684]
Predicted Effect probably benign
Transcript: ENSMUST00000099683
SMART Domains Protein: ENSMUSP00000097275
Gene: ENSMUSG00000075014

DomainStartEndE-ValueType
internal_repeat_1 1 41 1.13e-5 PROSPERO
internal_repeat_2 26 49 4.11e-5 PROSPERO
transmembrane domain 78 96 N/A INTRINSIC
internal_repeat_1 114 174 1.13e-5 PROSPERO
low complexity region 177 188 N/A INTRINSIC
internal_repeat_2 197 219 4.11e-5 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000099684
AA Change: R143T

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097276
Gene: ENSMUSG00000075015
AA Change: R143T

DomainStartEndE-ValueType
internal_repeat_1 2 73 1.19e-13 PROSPERO
internal_repeat_1 80 167 1.19e-13 PROSPERO
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Gm10801
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01100:Gm10801 APN 2 98663983 missense probably benign
IGL01154:Gm10801 APN 2 98663983 missense probably benign
PIT4131001:Gm10801 UTSW 2 98662303 missense probably benign
PIT4142001:Gm10801 UTSW 2 98662303 missense probably benign
R0026:Gm10801 UTSW 2 98663909 splice site probably benign
R0063:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R0334:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R0335:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R1172:Gm10801 UTSW 2 98663907 splice site probably benign
R1321:Gm10801 UTSW 2 98663907 splice site probably benign
R1871:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R1924:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R2163:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2306:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R2379:Gm10801 UTSW 2 98663840 missense probably benign 0.30
R3078:Gm10801 UTSW 2 98663852 missense probably damaging 1.00
R3605:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R3892:Gm10801 UTSW 2 98663901 splice site probably null
R3930:Gm10801 UTSW 2 98664016 missense possibly damaging 0.48
R4709:Gm10801 UTSW 2 98663901 splice site probably null
R5390:Gm10801 UTSW 2 98663806 small insertion probably benign
R5405:Gm10801 UTSW 2 98663806 small insertion probably benign
R5535:Gm10801 UTSW 2 98662499 frame shift probably null
R5653:Gm10801 UTSW 2 98664051 missense probably damaging 1.00
R5747:Gm10801 UTSW 2 98664007 missense possibly damaging 0.66
R5987:Gm10801 UTSW 2 98663807 nonsense probably null
R6086:Gm10801 UTSW 2 98663803 nonsense probably null
R6090:Gm10801 UTSW 2 98663806 small insertion probably benign
R6093:Gm10801 UTSW 2 98663807 nonsense probably null
R6112:Gm10801 UTSW 2 98664064 missense probably benign 0.00
R6184:Gm10801 UTSW 2 98663806 small insertion probably benign
R6352:Gm10801 UTSW 2 98663806 small insertion probably benign
R6357:Gm10801 UTSW 2 98663807 frame shift probably null
R6395:Gm10801 UTSW 2 98663807 small insertion probably benign
R6514:Gm10801 UTSW 2 98663869 missense probably benign 0.19
R6547:Gm10801 UTSW 2 98663803 nonsense probably null
R6560:Gm10801 UTSW 2 98663807 nonsense probably null
R6640:Gm10801 UTSW 2 98663807 nonsense probably null
R6675:Gm10801 UTSW 2 98663806 small insertion probably benign
R6679:Gm10801 UTSW 2 98663806 small insertion probably benign
R6684:Gm10801 UTSW 2 98663807 nonsense probably null
R6758:Gm10801 UTSW 2 98663807 nonsense probably null
R6786:Gm10801 UTSW 2 98663803 nonsense probably null
R6886:Gm10801 UTSW 2 98663806 small insertion probably benign
R7783:Gm10801 UTSW 2 98663807 nonsense probably null
R7823:Gm10801 UTSW 2 98663807 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCCATCTGTGTAGAAAGCTG -3'
(R):5'- GTCTACTAAGGAGGCCACAAAC -3'

Sequencing Primer
(F):5'- CCAGGTCTTACAGTGTGCAC -3'
(R):5'- TCTACTAAGGAGGCCACAAACAACTG -3'
Posted On2015-10-08