Incidental Mutation 'R4638:Srp72'
ID350791
Institutional Source Beutler Lab
Gene Symbol Srp72
Ensembl Gene ENSMUSG00000036323
Gene Namesignal recognition particle 72
Synonyms72kDa, 5730576P14Rik
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location76974683-76999937 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76990295 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 309 (E309G)
Ref Sequence ENSEMBL: ENSMUSP00000113312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101087] [ENSMUST00000120550]
Predicted Effect probably benign
Transcript: ENSMUST00000101087
AA Change: E370G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098648
Gene: ENSMUSG00000036323
AA Change: E370G

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 70 2.7e-2 PFAM
Pfam:SRP_TPR_like 30 157 5.5e-25 PFAM
Pfam:TPR_8 176 208 2.3e-3 PFAM
Pfam:TPR_1 226 259 2.4e-4 PFAM
Pfam:TPR_2 226 259 4.9e-5 PFAM
Pfam:TPR_8 226 259 1.1e-2 PFAM
Pfam:TPR_9 412 490 1.3e-3 PFAM
Pfam:SRP72 531 588 6.2e-26 PFAM
low complexity region 630 639 N/A INTRINSIC
low complexity region 647 668 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120550
AA Change: E309G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113312
Gene: ENSMUSG00000036323
AA Change: E309G

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:TPR_9 19 72 2.5e-2 PFAM
Blast:TPR 109 142 2e-11 BLAST
Blast:TPR 176 209 5e-10 BLAST
Pfam:TPR_6 280 310 2.5e-3 PFAM
Pfam:TPR_9 351 429 1.4e-3 PFAM
Pfam:SRP72 465 527 5.8e-24 PFAM
low complexity region 569 578 N/A INTRINSIC
low complexity region 586 607 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141873
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146167
Meta Mutation Damage Score 0.0646 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the 72 kDa subunit of the signal recognition particle (SRP), a ribonucleoprotein complex that mediates the targeting of secretory proteins to the endoplasmic reticulum (ER). The SRP complex consists of a 7S RNA and 6 protein subunits: SRP9, SRP14, SRP19, SRP54, SRP68, and SRP72, that are bound to the 7S RNA as monomers or heterodimers. SRP has at least 3 distinct functions that can be associated with the protein subunits: signal recognition, translational arrest, and ER membrane targeting by interaction with the docking protein. Mutations in this gene are associated with familial bone marrow failure. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2012]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Srp72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00473:Srp72 APN 5 76984176 missense probably damaging 1.00
IGL00915:Srp72 APN 5 76978613 nonsense probably null
IGL02731:Srp72 APN 5 76994215 missense probably damaging 0.98
PIT4468001:Srp72 UTSW 5 76994206 missense probably benign
R0009:Srp72 UTSW 5 76987885 missense probably damaging 0.98
R0318:Srp72 UTSW 5 76984200 missense probably benign 0.27
R1645:Srp72 UTSW 5 76998278 missense probably benign 0.05
R1678:Srp72 UTSW 5 76980307 missense probably damaging 1.00
R1682:Srp72 UTSW 5 76987870 missense possibly damaging 0.95
R2037:Srp72 UTSW 5 76976491 missense probably damaging 1.00
R2364:Srp72 UTSW 5 76984362 missense probably benign 0.00
R2876:Srp72 UTSW 5 76995920 splice site probably benign
R4072:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4073:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4074:Srp72 UTSW 5 76998251 missense probably benign 0.24
R4803:Srp72 UTSW 5 76984384 missense probably damaging 0.97
R4864:Srp72 UTSW 5 76984162 missense probably benign 0.35
R5188:Srp72 UTSW 5 76974751 missense possibly damaging 0.54
R5217:Srp72 UTSW 5 76980528 missense probably damaging 1.00
R5459:Srp72 UTSW 5 76984338 missense probably benign 0.16
R5616:Srp72 UTSW 5 76987934 missense probably damaging 1.00
R6460:Srp72 UTSW 5 76987991 missense probably damaging 1.00
R6595:Srp72 UTSW 5 76984200 missense probably benign 0.27
R6959:Srp72 UTSW 5 76994223 missense possibly damaging 0.91
R6986:Srp72 UTSW 5 76994876 missense probably benign 0.16
R7674:Srp72 UTSW 5 76974826 missense probably damaging 0.98
Z1177:Srp72 UTSW 5 76998353 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTAAAGCACTGGGGTTG -3'
(R):5'- CCTGAGACTCGTTCTAACACAGG -3'

Sequencing Primer
(F):5'- TGCACACAGAAACCTTGTCTTAGG -3'
(R):5'- GTTCTAACACAGGACCAACTCAAGG -3'
Posted On2015-10-08