Incidental Mutation 'R4638:Krba1'
ID350792
Institutional Source Beutler Lab
Gene Symbol Krba1
Ensembl Gene ENSMUSG00000042810
Gene NameKRAB-A domain containing 1
SynonymsA930040G15Rik
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48395586-48419781 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 48409751 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 441 (L441*)
Ref Sequence ENSEMBL: ENSMUSP00000145256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031815] [ENSMUST00000077093] [ENSMUST00000114571] [ENSMUST00000114572] [ENSMUST00000203371]
Predicted Effect probably null
Transcript: ENSMUST00000031815
AA Change: L431*
SMART Domains Protein: ENSMUSP00000031815
Gene: ENSMUSG00000042810
AA Change: L431*

DomainStartEndE-ValueType
low complexity region 31 43 N/A INTRINSIC
KRBA1 154 197 1.27e-3 SMART
KRBA1 249 291 3.23e-14 SMART
KRBA1 310 355 8.27e-12 SMART
KRBA1 357 399 4.98e-6 SMART
low complexity region 452 459 N/A INTRINSIC
KRBA1 474 516 6.03e-14 SMART
KRBA1 576 619 7.71e-12 SMART
coiled coil region 814 847 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000077093
AA Change: L442*
SMART Domains Protein: ENSMUSP00000076345
Gene: ENSMUSG00000042810
AA Change: L442*

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114571
AA Change: L442*
SMART Domains Protein: ENSMUSP00000110218
Gene: ENSMUSG00000042810
AA Change: L442*

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 193 235 3.23e-14 SMART
KRBA1 254 299 8.27e-12 SMART
KRBA1 367 409 7.26e-8 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 6.03e-14 SMART
KRBA1 586 629 7.71e-12 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114572
AA Change: L477*
SMART Domains Protein: ENSMUSP00000110219
Gene: ENSMUSG00000042810
AA Change: L477*

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 98 141 1.27e-3 SMART
KRBA1 194 236 3.23e-14 SMART
KRBA1 255 300 8.27e-12 SMART
KRBA1 368 410 7.26e-8 SMART
low complexity region 463 470 N/A INTRINSIC
KRBA1 485 527 6.03e-14 SMART
KRBA1 587 630 7.71e-12 SMART
coiled coil region 825 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148697
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154536
Predicted Effect probably null
Transcript: ENSMUST00000203371
AA Change: L441*
SMART Domains Protein: ENSMUSP00000145256
Gene: ENSMUSG00000042810
AA Change: L441*

DomainStartEndE-ValueType
Blast:KRAB 1 34 2e-12 BLAST
KRBA1 97 140 8.1e-8 SMART
KRBA1 193 235 2.5e-18 SMART
KRBA1 254 299 6.4e-16 SMART
KRBA1 367 409 5.7e-12 SMART
low complexity region 462 469 N/A INTRINSIC
KRBA1 484 526 4.6e-18 SMART
KRBA1 586 629 5.8e-16 SMART
coiled coil region 824 857 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204554
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Krba1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Krba1 APN 6 48406318 missense possibly damaging 0.95
IGL01663:Krba1 APN 6 48411754 missense probably damaging 0.99
IGL01764:Krba1 APN 6 48415836 missense probably benign 0.01
IGL02036:Krba1 APN 6 48415642 missense possibly damaging 0.95
IGL02333:Krba1 APN 6 48413087 missense probably damaging 0.99
IGL02681:Krba1 APN 6 48404118 missense probably damaging 1.00
IGL03069:Krba1 APN 6 48414549 missense possibly damaging 0.53
IGL03380:Krba1 APN 6 48403453 missense possibly damaging 0.53
PIT4151001:Krba1 UTSW 6 48402897 missense probably damaging 0.99
R0077:Krba1 UTSW 6 48405225 splice site probably benign
R0504:Krba1 UTSW 6 48416254 missense probably benign 0.07
R1051:Krba1 UTSW 6 48413398 missense possibly damaging 0.82
R1875:Krba1 UTSW 6 48414049 splice site probably null
R1912:Krba1 UTSW 6 48415765 missense probably benign 0.45
R2084:Krba1 UTSW 6 48414568 missense probably damaging 1.00
R4035:Krba1 UTSW 6 48411680 missense probably damaging 1.00
R4291:Krba1 UTSW 6 48415665 missense possibly damaging 0.93
R4568:Krba1 UTSW 6 48409723 missense probably damaging 0.98
R4619:Krba1 UTSW 6 48406348 nonsense probably null
R4913:Krba1 UTSW 6 48406957 missense probably benign 0.00
R5174:Krba1 UTSW 6 48412295 missense probably damaging 1.00
R5487:Krba1 UTSW 6 48404039 missense probably damaging 1.00
R5496:Krba1 UTSW 6 48406356 missense possibly damaging 0.54
R5514:Krba1 UTSW 6 48413495 missense probably damaging 1.00
R5879:Krba1 UTSW 6 48415744 missense possibly damaging 0.89
R6351:Krba1 UTSW 6 48414128 missense probably benign 0.35
R6516:Krba1 UTSW 6 48413272 nonsense probably null
R7003:Krba1 UTSW 6 48413080 missense possibly damaging 0.71
R7135:Krba1 UTSW 6 48416299 missense probably benign 0.01
R7202:Krba1 UTSW 6 48412327 missense probably damaging 1.00
R7308:Krba1 UTSW 6 48406339 missense probably benign 0.04
R7936:Krba1 UTSW 6 48411669 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48413256 missense probably damaging 1.00
Z1177:Krba1 UTSW 6 48415894 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGACTTCTCCTTATTCCCAAGAG -3'
(R):5'- AGGACTACAACCTCAGCTGG -3'

Sequencing Primer
(F):5'- GGGTGCTAGATAGACTTTTCATCAG -3'
(R):5'- TACAACCTCAGCTGGACCAG -3'
Posted On2015-10-08