Incidental Mutation 'R4638:Pyroxd1'
ID350793
Institutional Source Beutler Lab
Gene Symbol Pyroxd1
Ensembl Gene ENSMUSG00000041671
Gene Namepyridine nucleotide-disulphide oxidoreductase domain 1
Synonyms
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location142345654-142363257 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to G at 142354741 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 199 (S199*)
Ref Sequence ENSEMBL: ENSMUSP00000036394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032370] [ENSMUST00000041852] [ENSMUST00000100832]
Predicted Effect probably benign
Transcript: ENSMUST00000032370
SMART Domains Protein: ENSMUSP00000032370
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 2.5e-27 SMART
HELICc 328 409 2.2e-26 SMART
Pfam:RQC 488 592 5.5e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000041852
AA Change: S199*
SMART Domains Protein: ENSMUSP00000036394
Gene: ENSMUSG00000041671
AA Change: S199*

DomainStartEndE-ValueType
Pfam:Pyr_redox_2 8 234 2.2e-18 PFAM
Pfam:Pyr_redox_2 266 381 4e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100832
SMART Domains Protein: ENSMUSP00000098394
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
coiled coil region 6 51 N/A INTRINSIC
DEXDc 88 291 6e-25 SMART
HELICc 328 409 5.51e-24 SMART
Pfam:RQC 488 592 1.1e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138578
Predicted Effect probably benign
Transcript: ENSMUST00000141504
SMART Domains Protein: ENSMUSP00000119452
Gene: ENSMUSG00000030243

DomainStartEndE-ValueType
Pfam:RecQ_Zn_bind 10 69 7.1e-16 PFAM
Pfam:RQC 73 187 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153912
Meta Mutation Damage Score 0.9712 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Pyroxd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Pyroxd1 APN 6 142361758 missense probably damaging 0.96
IGL01720:Pyroxd1 APN 6 142351058 splice site probably benign
IGL02139:Pyroxd1 APN 6 142354731 missense probably benign
IGL02930:Pyroxd1 APN 6 142359052 missense probably damaging 1.00
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0233:Pyroxd1 UTSW 6 142354630 missense possibly damaging 0.77
R0329:Pyroxd1 UTSW 6 142361976 missense probably benign 0.37
R0505:Pyroxd1 UTSW 6 142353562 missense possibly damaging 0.55
R0552:Pyroxd1 UTSW 6 142345737 missense probably benign 0.06
R1073:Pyroxd1 UTSW 6 142348644 critical splice donor site probably null
R1319:Pyroxd1 UTSW 6 142359148 missense probably benign 0.33
R2200:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R4639:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4640:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4641:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4642:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4643:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4645:Pyroxd1 UTSW 6 142354741 nonsense probably null
R4687:Pyroxd1 UTSW 6 142361868 missense probably benign 0.00
R5359:Pyroxd1 UTSW 6 142361991 missense probably damaging 1.00
R5688:Pyroxd1 UTSW 6 142353540 missense probably damaging 1.00
R6208:Pyroxd1 UTSW 6 142357456 missense probably benign 0.00
R6295:Pyroxd1 UTSW 6 142354753 missense probably benign 0.00
R7056:Pyroxd1 UTSW 6 142359082 missense probably benign 0.01
R7445:Pyroxd1 UTSW 6 142358501 missense probably benign 0.03
V1662:Pyroxd1 UTSW 6 142358443 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTCTGTGCAGTCCGCGTC -3'
(R):5'- GCCCTATGTATTTTCTAATCTGAACAT -3'

Sequencing Primer
(F):5'- GCACATAGCAGGCGTTCAG -3'
(R):5'- CATTCCTGCCTCCTGAATA -3'
Posted On2015-10-08