Incidental Mutation 'R4638:Cebpa'
ID350796
Institutional Source Beutler Lab
Gene Symbol Cebpa
Ensembl Gene ENSMUSG00000034957
Gene NameCCAAT/enhancer binding protein (C/EBP), alpha
SynonymsCebp, C/ebpalpha, C/EBP alpha
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35119293-35121928 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 35120262 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 282 (N282D)
Ref Sequence ENSEMBL: ENSMUSP00000096129 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042985] [ENSMUST00000205391]
Predicted Effect probably damaging
Transcript: ENSMUST00000042985
AA Change: N282D

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000096129
Gene: ENSMUSG00000034957
AA Change: N282D

DomainStartEndE-ValueType
low complexity region 29 54 N/A INTRINSIC
low complexity region 91 135 N/A INTRINSIC
low complexity region 181 201 N/A INTRINSIC
low complexity region 218 255 N/A INTRINSIC
low complexity region 262 278 N/A INTRINSIC
BRLZ 281 345 3.2e-13 SMART
Predicted Effect silent
Transcript: ENSMUST00000205391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205799
Meta Mutation Damage Score 0.0743 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: This intronless gene encodes a transcription factor that contains a basic leucine zipper (bZIP) domain and recognizes the CCAAT motif in the promoters of target genes. The encoded protein functions in homodimers and also heterodimers with CCAAT/enhancer-binding proteins beta and gamma. Activity of this protein can modulate the expression of genes involved in cell cycle regulation as well as in body weight homeostasis. The use of alternative in-frame non-AUG (CUG) and AUG start codons results in several protein isoforms with different lengths. Differential translation initiation is mediated by an out-of-frame, upstream open reading frame which is located between the CUG and the first AUG start codons. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects of the liver, neutrophils, lung, and brown fat, resulting in impaired glycogen storage and lipid accumulation, hypoglycemia, reduced uncoupling protein, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Cebpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0529:Cebpa UTSW 7 35120199 missense probably benign
R2061:Cebpa UTSW 7 35119522 missense probably damaging 0.96
R2211:Cebpa UTSW 7 35120466 missense probably damaging 1.00
R4869:Cebpa UTSW 7 35119821 missense probably damaging 0.97
R5269:Cebpa UTSW 7 35119858 missense probably benign 0.03
R7957:Cebpa UTSW 7 35120442 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTTGCAGTTCCAGATCGCG -3'
(R):5'- CTTGACCAAGGAGCTCTCAG -3'

Sequencing Primer
(F):5'- AGTTCCAGATCGCGCACTG -3'
(R):5'- AAGGAGCTCTCAGGCAGCTG -3'
Posted On2015-10-08