Incidental Mutation 'R4638:Olfr699'
ID350798
Institutional Source Beutler Lab
Gene Symbol Olfr699
Ensembl Gene ENSMUSG00000096714
Gene Nameolfactory receptor 699
SynonymsMOR283-10P, GA_x6K02T2PBJ9-9168355-9167405
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location106787963-106793198 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) A to T at 106790998 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000149112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065024] [ENSMUST00000215952] [ENSMUST00000216307]
Predicted Effect probably null
Transcript: ENSMUST00000065024
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068023
Gene: ENSMUSG00000096714
AA Change: M1K

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 303 2.1e-5 PFAM
Pfam:7tm_1 41 290 1.1e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000215952
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably null
Transcript: ENSMUST00000216307
AA Change: M1K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9608 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Olfr699
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Olfr699 APN 7 106790589 missense probably benign 0.12
IGL02093:Olfr699 APN 7 106790823 missense probably benign 0.12
IGL02404:Olfr699 APN 7 106790359 missense probably damaging 1.00
IGL03214:Olfr699 APN 7 106790345 missense probably benign
IGL03230:Olfr699 APN 7 106790704 missense probably damaging 1.00
R0194:Olfr699 UTSW 7 106790823 missense probably benign 0.12
R0523:Olfr699 UTSW 7 106790326 missense probably damaging 1.00
R1132:Olfr699 UTSW 7 106790551 missense possibly damaging 0.94
R1373:Olfr699 UTSW 7 106790756 missense probably benign 0.01
R1482:Olfr699 UTSW 7 106790333 missense probably benign 0.00
R1498:Olfr699 UTSW 7 106790416 missense possibly damaging 0.78
R1500:Olfr699 UTSW 7 106790821 missense probably damaging 1.00
R2656:Olfr699 UTSW 7 106790513 missense probably damaging 0.98
R4163:Olfr699 UTSW 7 106790279 missense probably damaging 1.00
R5104:Olfr699 UTSW 7 106790332 missense possibly damaging 0.81
R6216:Olfr699 UTSW 7 106790458 missense probably benign 0.23
R6976:Olfr699 UTSW 7 106790227 missense probably damaging 0.99
R7129:Olfr699 UTSW 7 106790483 missense probably benign 0.00
R7130:Olfr699 UTSW 7 106790182 missense probably benign 0.35
R8104:Olfr699 UTSW 7 106791130 start gained probably benign
R8104:Olfr699 UTSW 7 106791131 start gained probably benign
Z1177:Olfr699 UTSW 7 106790270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCTTGGGGATAATAATTGATGTG -3'
(R):5'- CCACTTAGACACATCTTTCTTCAAG -3'

Sequencing Primer
(F):5'- TCTATGAGAGAGAGCTGCCC -3'
(R):5'- TACTGGAGTCCTGTTGAG -3'
Posted On2015-10-08