Incidental Mutation 'R4638:Cngb1'
ID350800
Institutional Source Beutler Lab
Gene Symbol Cngb1
Ensembl Gene ENSMUSG00000031789
Gene Namecyclic nucleotide gated channel beta 1
SynonymsBC016201, Cngb1b, Cngb1
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location95239045-95306585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 95266019 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 196 (T196M)
Ref Sequence ENSEMBL: ENSMUSP00000112437 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119870] [ENSMUST00000120044] [ENSMUST00000121162]
Predicted Effect probably damaging
Transcript: ENSMUST00000119870
AA Change: T655M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113827
Gene: ENSMUSG00000031789
AA Change: T655M

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
Pfam:Ion_trans 83 315 9.8e-17 PFAM
cNMP 389 508 4.1e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120044
AA Change: T196M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113750
Gene: ENSMUSG00000031789
AA Change: T196M

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121162
AA Change: T196M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112437
Gene: ENSMUSG00000031789
AA Change: T196M

DomainStartEndE-ValueType
low complexity region 20 46 N/A INTRINSIC
transmembrane domain 79 101 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
low complexity region 169 182 N/A INTRINSIC
cNMP 389 508 4e-25 SMART
low complexity region 555 596 N/A INTRINSIC
low complexity region 599 636 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype PHENOTYPE: Homozygous null mice display postnatal lethality, reduced body size and weight, and retinal rod degeneration followed by cone degeneration. Mice homozygous for an allele lacking the calmodulin-binding domain exhibit defective olfactory neural signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Cngb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cngb1 APN 8 95242184 splice site probably benign
IGL01575:Cngb1 APN 8 95264520 missense possibly damaging 0.51
IGL02329:Cngb1 APN 8 95242359 missense probably benign 0.14
IGL03332:Cngb1 APN 8 95298846 splice site probably benign
IGL03391:Cngb1 APN 8 95303705 unclassified probably benign
stevie UTSW 8 95260130 missense probably damaging 1.00
R0078:Cngb1 UTSW 8 95264545 critical splice acceptor site probably null
R0116:Cngb1 UTSW 8 95260638 missense probably damaging 1.00
R1073:Cngb1 UTSW 8 95303567 critical splice donor site probably null
R1166:Cngb1 UTSW 8 95260181 missense probably damaging 0.99
R1714:Cngb1 UTSW 8 95257931 missense probably damaging 1.00
R1753:Cngb1 UTSW 8 95297773 critical splice donor site probably benign
R1760:Cngb1 UTSW 8 95299700 missense probably benign 0.03
R1833:Cngb1 UTSW 8 95242355 missense probably damaging 1.00
R1935:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1939:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R1940:Cngb1 UTSW 8 95299692 missense probably damaging 1.00
R2045:Cngb1 UTSW 8 95297085 splice site probably null
R2379:Cngb1 UTSW 8 95260130 missense probably damaging 1.00
R2940:Cngb1 UTSW 8 95252107 missense probably benign 0.44
R4034:Cngb1 UTSW 8 95264450 missense possibly damaging 0.47
R4058:Cngb1 UTSW 8 95267654 missense probably benign 0.00
R4425:Cngb1 UTSW 8 95299716 missense probably damaging 1.00
R4585:Cngb1 UTSW 8 95297128 critical splice acceptor site probably null
R4591:Cngb1 UTSW 8 95253384 missense probably damaging 1.00
R4906:Cngb1 UTSW 8 95251973 missense probably damaging 0.96
R4950:Cngb1 UTSW 8 95248507 missense probably damaging 1.00
R4979:Cngb1 UTSW 8 95259157 missense probably damaging 0.99
R5148:Cngb1 UTSW 8 95265983 missense probably benign 0.28
R5474:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5475:Cngb1 UTSW 8 95251969 missense probably damaging 1.00
R5545:Cngb1 UTSW 8 95252173 missense
R5585:Cngb1 UTSW 8 95263139 missense probably damaging 1.00
R5637:Cngb1 UTSW 8 95257921 missense probably damaging 1.00
R5785:Cngb1 UTSW 8 95254195 missense possibly damaging 0.90
R5967:Cngb1 UTSW 8 95251906 missense probably damaging 1.00
R6013:Cngb1 UTSW 8 95284321 unclassified probably benign
R6049:Cngb1 UTSW 8 95270842 missense probably damaging 0.99
R6370:Cngb1 UTSW 8 95264422 missense probably benign 0.33
R6377:Cngb1 UTSW 8 95248980 missense probably damaging 1.00
R6401:Cngb1 UTSW 8 95303739 unclassified probably benign
R6427:Cngb1 UTSW 8 95297759 intron probably benign
R6492:Cngb1 UTSW 8 95264424 missense probably benign 0.01
R6613:Cngb1 UTSW 8 95266010 missense possibly damaging 0.95
R6721:Cngb1 UTSW 8 95270888 missense probably benign 0.05
R6919:Cngb1 UTSW 8 95248375 missense probably null 1.00
R7012:Cngb1 UTSW 8 95257955 missense possibly damaging 0.83
R7418:Cngb1 UTSW 8 95278259 nonsense probably null
R7464:Cngb1 UTSW 8 95254183 missense possibly damaging 0.92
R7806:Cngb1 UTSW 8 95298804 critical splice donor site probably null
R8048:Cngb1 UTSW 8 95263210 missense possibly damaging 0.90
R8074:Cngb1 UTSW 8 95252173 missense
R8189:Cngb1 UTSW 8 95303620 unclassified probably benign
R8245:Cngb1 UTSW 8 95297780 missense unknown
R8286:Cngb1 UTSW 8 95275624 missense
RF010:Cngb1 UTSW 8 95303650 frame shift probably null
RF053:Cngb1 UTSW 8 95303648 frame shift probably null
T0722:Cngb1 UTSW 8 95296650 missense probably benign 0.02
T0722:Cngb1 UTSW 8 95297819 missense probably damaging 0.99
T0722:Cngb1 UTSW 8 95303696 unclassified probably benign
T0722:Cngb1 UTSW 8 95303714 unclassified probably benign
Z1177:Cngb1 UTSW 8 95252136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAAGGCCAAGTTCACCTTTG -3'
(R):5'- AGACATTACCCAGCTCAGGC -3'

Sequencing Primer
(F):5'- TCCACTCCTTAGTACATACCTAAGC -3'
(R):5'- TCAGGCCTGAGGTCCTG -3'
Posted On2015-10-08