Incidental Mutation 'R4638:Slc12a8'
ID350808
Institutional Source Beutler Lab
Gene Symbol Slc12a8
Ensembl Gene ENSMUSG00000035506
Gene Namesolute carrier family 12 (potassium/chloride transporters), member 8
Synonyms
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location33517328-33664135 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 33590323 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 200 (S200A)
Ref Sequence ENSEMBL: ENSMUSP00000113633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059056] [ENSMUST00000119173] [ENSMUST00000121925] [ENSMUST00000122427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059056
AA Change: S231A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000062337
Gene: ENSMUSG00000035506
AA Change: S231A

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 410 4e-24 PFAM
Pfam:AA_permease 43 409 5.3e-51 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119173
AA Change: S200A

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113633
Gene: ENSMUSG00000035506
AA Change: S200A

DomainStartEndE-ValueType
Pfam:AA_permease_2 7 266 4.2e-15 PFAM
Pfam:AA_permease 12 267 1.9e-37 PFAM
transmembrane domain 295 317 N/A INTRINSIC
low complexity region 401 416 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
transmembrane domain 532 554 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121925
AA Change: S231A

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112439
Gene: ENSMUSG00000035506
AA Change: S231A

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 409 2.4e-23 PFAM
Pfam:AA_permease 43 409 5e-50 PFAM
low complexity region 481 496 N/A INTRINSIC
transmembrane domain 585 607 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000122427
AA Change: S231A

PolyPhen 2 Score 0.830 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113164
Gene: ENSMUSG00000035506
AA Change: S231A

DomainStartEndE-ValueType
Pfam:AA_permease_2 38 386 7.7e-18 PFAM
Pfam:AA_permease 43 381 1.3e-44 PFAM
low complexity region 455 470 N/A INTRINSIC
Meta Mutation Damage Score 0.1331 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to be a candidate for psoriasis susceptibility. Several alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg8 A G 17: 84,691,941 D155G probably damaging Het
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Slc12a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Slc12a8 APN 16 33540897 missense probably damaging 1.00
IGL01701:Slc12a8 APN 16 33540910 missense probably damaging 1.00
IGL02024:Slc12a8 APN 16 33608198 missense probably damaging 1.00
IGL02223:Slc12a8 APN 16 33624690 missense probably damaging 1.00
IGL02637:Slc12a8 APN 16 33534960 missense probably benign 0.05
IGL03248:Slc12a8 APN 16 33551027 missense probably damaging 1.00
R0136:Slc12a8 UTSW 16 33608213 missense probably damaging 1.00
R0436:Slc12a8 UTSW 16 33551085 missense probably damaging 1.00
R0586:Slc12a8 UTSW 16 33658230 missense possibly damaging 0.87
R0669:Slc12a8 UTSW 16 33550904 missense possibly damaging 0.91
R0780:Slc12a8 UTSW 16 33646665 splice site probably null
R1170:Slc12a8 UTSW 16 33662977 missense probably damaging 1.00
R1383:Slc12a8 UTSW 16 33534987 missense probably damaging 1.00
R1707:Slc12a8 UTSW 16 33551007 missense probably damaging 1.00
R2917:Slc12a8 UTSW 16 33550926 missense probably damaging 1.00
R4092:Slc12a8 UTSW 16 33617121 missense probably damaging 1.00
R4532:Slc12a8 UTSW 16 33551033 missense probably damaging 1.00
R4604:Slc12a8 UTSW 16 33608159 missense probably damaging 1.00
R4908:Slc12a8 UTSW 16 33606259 splice site probably null
R5148:Slc12a8 UTSW 16 33624918 missense probably benign 0.00
R5186:Slc12a8 UTSW 16 33617208 missense probably damaging 1.00
R5711:Slc12a8 UTSW 16 33590309 missense probably damaging 1.00
R5760:Slc12a8 UTSW 16 33624785 nonsense probably null
R6122:Slc12a8 UTSW 16 33625014 missense probably damaging 0.99
R6592:Slc12a8 UTSW 16 33617256 critical splice donor site probably null
R6995:Slc12a8 UTSW 16 33534893 nonsense probably null
R7602:Slc12a8 UTSW 16 33625124 missense probably benign 0.00
R7772:Slc12a8 UTSW 16 33550965 missense probably damaging 1.00
R7849:Slc12a8 UTSW 16 33624560 missense probably damaging 1.00
R8022:Slc12a8 UTSW 16 33625086 missense probably benign 0.01
R8293:Slc12a8 UTSW 16 33540978 missense probably benign 0.07
R8345:Slc12a8 UTSW 16 33550951 missense probably benign 0.02
Z1176:Slc12a8 UTSW 16 33540965 frame shift probably null
Z1176:Slc12a8 UTSW 16 33606173 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GCACATGTATTGCCTAAGAATGTTC -3'
(R):5'- GTGAGGCAAGAGCTCTATAGTCTC -3'

Sequencing Primer
(F):5'- TTATCCCAGCAACTCAGGAGGTTG -3'
(R):5'- GGCAAGAGCTCTATAGTCTCCTTCAG -3'
Posted On2015-10-08