Incidental Mutation 'R4638:Abcg8'
ID350811
Institutional Source Beutler Lab
Gene Symbol Abcg8
Ensembl Gene ENSMUSG00000024254
Gene NameATP binding cassette subfamily G member 8
Synonyms1300003C16Rik, Sterolin-2
MMRRC Submission 041900-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4638 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location84676302-84700333 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 84691941 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 155 (D155G)
Ref Sequence ENSEMBL: ENSMUSP00000126675 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045714] [ENSMUST00000170725] [ENSMUST00000171915]
Predicted Effect probably damaging
Transcript: ENSMUST00000045714
AA Change: D156G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035246
Gene: ENSMUSG00000024254
AA Change: D156G

DomainStartEndE-ValueType
Pfam:ABC_tran 89 242 2.1e-29 PFAM
Pfam:ABC2_membrane 397 608 1.7e-36 PFAM
transmembrane domain 640 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170725
AA Change: D29G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127785
Gene: ENSMUSG00000024254
AA Change: D29G

DomainStartEndE-ValueType
Pfam:ABC_tran 1 115 2.6e-18 PFAM
Pfam:ABC2_membrane 270 481 7.4e-38 PFAM
transmembrane domain 513 535 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171915
AA Change: D155G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126675
Gene: ENSMUSG00000024254
AA Change: D155G

DomainStartEndE-ValueType
Pfam:ABC_tran 88 241 7.5e-30 PFAM
Pfam:ABC2_membrane 396 607 1.7e-37 PFAM
transmembrane domain 639 661 N/A INTRINSIC
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 91% (40/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. The protein encoded by this gene functions to exclude non-cholesterol sterol entry at the intestinal level, promote excretion of cholesterol and sterols into bile, and to facilitate transport of sterols back into the intestinal lumen. It is expressed in a tissue-specific manner in the liver, intestine, and gallbladder. This gene is tandemly arrayed on chromosome 2, in a head-to-head orientation with family member ABCG5. Mutations in this gene may contribute to sterol accumulation and atherosclerosis, and have been observed in patients with sitosterolemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants fail to secrete cholesterol into bile and exhibit increased plasma and tissue plant sterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano4 C T 10: 88,954,697 A847T probably damaging Het
B4galt7 T C 13: 55,600,146 probably benign Het
Camk1g T A 1: 193,356,359 D85V probably damaging Het
Caskin1 G A 17: 24,506,628 S1296N probably benign Het
Cebpa A G 7: 35,120,262 N282D probably damaging Het
Cngb1 G A 8: 95,266,019 T196M probably damaging Het
Cobll1 T C 2: 65,099,237 M619V probably benign Het
Coro7 A T 16: 4,632,287 I566N probably damaging Het
Dpyd A T 3: 119,266,077 S808C probably benign Het
Fbn2 A G 18: 58,010,304 V2893A probably benign Het
Gm10801 G C 2: 98,664,007 R143T possibly damaging Het
Krba1 T A 6: 48,409,751 L441* probably null Het
Lama5 T C 2: 180,190,413 T1712A possibly damaging Het
Lnpep G A 17: 17,575,307 T314I probably damaging Het
Lyst T C 13: 13,696,794 probably null Het
Naa16 C A 14: 79,340,033 probably null Het
Nek7 A T 1: 138,544,300 F34Y probably benign Het
Olfr1126 T C 2: 87,457,983 S273P possibly damaging Het
Olfr699 A T 7: 106,790,998 M1K probably null Het
Park7 G A 4: 150,907,099 Q45* probably null Het
Pclo C A 5: 14,680,433 S2983* probably null Het
Pth1r A G 9: 110,727,073 L244P possibly damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Slc11a1 G A 1: 74,375,278 probably benign Het
Slc12a8 T G 16: 33,590,323 S200A possibly damaging Het
Slc7a10 A G 7: 35,197,930 E262G probably damaging Het
Smg1 T C 7: 118,195,926 probably benign Het
Snapc4 A G 2: 26,365,302 L1070P probably damaging Het
Sp2 A G 11: 96,957,474 I435T possibly damaging Het
Srp72 A G 5: 76,990,295 E309G probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tie1 C T 4: 118,483,842 R314H probably benign Het
Tmem198 G T 1: 75,479,707 G2* probably null Het
Tmem81 A G 1: 132,508,205 probably benign Het
Ttn A T 2: 76,822,477 V10938E possibly damaging Het
Zfp773 T A 7: 7,135,336 Y100F probably damaging Het
Other mutations in Abcg8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Abcg8 APN 17 84688529 splice site probably null
IGL01019:Abcg8 APN 17 84691995 missense probably benign 0.21
IGL02498:Abcg8 APN 17 84683265 missense probably benign
IGL02506:Abcg8 APN 17 84692488 missense possibly damaging 0.84
IGL03077:Abcg8 APN 17 84691880 missense probably damaging 1.00
R0086:Abcg8 UTSW 17 84692771 missense probably damaging 1.00
R0130:Abcg8 UTSW 17 84686666 missense probably damaging 1.00
R0930:Abcg8 UTSW 17 84683277 missense probably benign 0.00
R1466:Abcg8 UTSW 17 84686727 splice site probably benign
R1493:Abcg8 UTSW 17 84696679 missense probably damaging 1.00
R1628:Abcg8 UTSW 17 84691991 nonsense probably null
R1916:Abcg8 UTSW 17 84688530 critical splice acceptor site probably null
R1935:Abcg8 UTSW 17 84694989 splice site probably benign
R1971:Abcg8 UTSW 17 84695159 splice site probably benign
R4693:Abcg8 UTSW 17 84696697 missense probably damaging 1.00
R5182:Abcg8 UTSW 17 84692744 missense probably damaging 1.00
R5227:Abcg8 UTSW 17 84691821 missense probably damaging 1.00
R5621:Abcg8 UTSW 17 84695993 missense probably damaging 0.96
R5772:Abcg8 UTSW 17 84686699 missense probably damaging 1.00
R7315:Abcg8 UTSW 17 84696714 missense probably damaging 0.99
R7709:Abcg8 UTSW 17 84692491 missense probably damaging 0.99
R7951:Abcg8 UTSW 17 84697529 missense probably damaging 1.00
R8231:Abcg8 UTSW 17 84692785 missense probably damaging 1.00
Z1177:Abcg8 UTSW 17 84692006 missense possibly damaging 0.95
Z1177:Abcg8 UTSW 17 84695030 nonsense probably null
Z1177:Abcg8 UTSW 17 84696118 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCTTCTGAAGAGCAGTTCC -3'
(R):5'- AGCTAGACTGGGTCTTCTGG -3'

Sequencing Primer
(F):5'- AGAGCAGTTCCGGCGCTTC -3'
(R):5'- CTAGACTGGGTCTTCTGGCAAAC -3'
Posted On2015-10-08