Incidental Mutation 'R4639:Olfr1036'
ID350816
Institutional Source Beutler Lab
Gene Symbol Olfr1036
Ensembl Gene ENSMUSG00000099820
Gene Nameolfactory receptor 1036
SynonymsGA_x6K02T2Q125-47549689-47550621, MOR245-25, MOR262-13
MMRRC Submission 041901-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R4639 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location86073992-86077194 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 86075579 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 280 (I280V)
Ref Sequence ENSEMBL: ENSMUSP00000130843 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164985]
Predicted Effect probably benign
Transcript: ENSMUST00000164985
AA Change: I280V

PolyPhen 2 Score 0.238 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000130843
Gene: ENSMUSG00000099820
AA Change: I280V

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.2e-51 PFAM
Pfam:7tm_1 39 288 1.1e-21 PFAM
Meta Mutation Damage Score 0.3321 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Atad2b A C 12: 5,018,053 H1017P probably damaging Het
Atp8a1 A T 5: 67,655,974 V943D probably benign Het
Babam1 C T 8: 71,404,307 A304V probably damaging Het
BC080695 C T 4: 143,571,897 R137C probably benign Het
Cdk5rap2 G T 4: 70,302,176 A584D probably damaging Het
Ddx21 A T 10: 62,591,837 L429* probably null Het
Dsp T C 13: 38,196,784 Y2502H probably damaging Het
Eaf1 G A 14: 31,504,376 D206N probably benign Het
Fam43b T A 4: 138,395,967 D14V possibly damaging Het
Fanca T A 8: 123,318,150 K34I probably damaging Het
Fzd4 T C 7: 89,407,317 Y191H probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10479 A G 12: 20,433,342 T55A probably damaging Het
Gsr T G 8: 33,697,256 I488M probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Myh13 T C 11: 67,341,551 M517T possibly damaging Het
Naip1 C G 13: 100,444,283 G152A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nat10 G A 2: 103,734,889 T449I probably benign Het
Nin A G 12: 70,038,601 S1619P probably damaging Het
Olfr297 G A 7: 86,526,761 M1I probably null Het
Pcdh15 A G 10: 74,643,607 T448A probably benign Het
Pcolce2 A G 9: 95,637,877 probably null Het
Pnp C T 14: 50,950,923 R207* probably null Het
Ppl A G 16: 5,089,446 V995A probably damaging Het
Ppp2r2a G A 14: 67,038,957 T33I probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rgs16 G T 1: 153,742,035 C97F probably damaging Het
Sacs T A 14: 61,207,268 D2254E probably benign Het
Slc6a17 T C 3: 107,474,281 M495V probably benign Het
Svep1 T C 4: 58,082,724 I1967V probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tcp11l2 A G 10: 84,584,936 D13G probably damaging Het
Vmn1r167 T C 7: 23,505,586 I2V probably benign Het
Vwa5a T C 9: 38,727,114 probably null Het
Wdr95 T C 5: 149,581,814 probably benign Het
Other mutations in Olfr1036
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02260:Olfr1036 APN 2 86075472 missense possibly damaging 0.90
IGL02370:Olfr1036 APN 2 86074788 missense probably damaging 0.98
R0269:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0409:Olfr1036 UTSW 2 86075302 nonsense probably null
R0412:Olfr1036 UTSW 2 86075091 missense probably benign 0.16
R0617:Olfr1036 UTSW 2 86075141 missense probably benign 0.03
R0846:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R1251:Olfr1036 UTSW 2 86074820 missense probably benign 0.20
R1646:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
R1670:Olfr1036 UTSW 2 86075250 missense probably benign
R1775:Olfr1036 UTSW 2 86074760 missense possibly damaging 0.88
R1968:Olfr1036 UTSW 2 86075205 missense probably damaging 1.00
R2877:Olfr1036 UTSW 2 86075331 missense possibly damaging 0.82
R4957:Olfr1036 UTSW 2 86075510 missense probably damaging 1.00
R5267:Olfr1036 UTSW 2 86075538 missense probably benign 0.28
R5862:Olfr1036 UTSW 2 86075646 missense probably benign 0.00
R6235:Olfr1036 UTSW 2 86075166 missense possibly damaging 0.66
R6355:Olfr1036 UTSW 2 86074872 missense probably benign 0.04
R6943:Olfr1036 UTSW 2 86074920 missense probably damaging 1.00
R8033:Olfr1036 UTSW 2 86074875 missense possibly damaging 0.61
R8796:Olfr1036 UTSW 2 86075174 missense possibly damaging 0.94
R8861:Olfr1036 UTSW 2 86075616 missense probably damaging 0.98
Z1088:Olfr1036 UTSW 2 86075323 missense possibly damaging 0.66
Z1177:Olfr1036 UTSW 2 86075424 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCTGTGTTACGCATGCAC -3'
(R):5'- AAGCATCACTGTGGATAACTGG -3'

Sequencing Primer
(F):5'- TTACGCATGCACTCGGCTG -3'
(R):5'- CACTGTGGATAACTGGATCTTATGAG -3'
Posted On2015-10-08