Incidental Mutation 'R4639:Nat10'
ID350817
Institutional Source Beutler Lab
Gene Symbol Nat10
Ensembl Gene ENSMUSG00000027185
Gene NameN-acetyltransferase 10
Synonyms
MMRRC Submission 041901-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4639 (G1)
Quality Score216
Status Validated
Chromosome2
Chromosomal Location103721256-103761270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 103734889 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 449 (T449I)
Ref Sequence ENSEMBL: ENSMUSP00000028608 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028608]
Predicted Effect probably benign
Transcript: ENSMUST00000028608
AA Change: T449I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000028608
Gene: ENSMUSG00000027185
AA Change: T449I

DomainStartEndE-ValueType
Pfam:DUF1726 107 201 6.9e-39 PFAM
low complexity region 226 242 N/A INTRINSIC
Pfam:Helicase_RecD 281 488 1.3e-68 PFAM
Pfam:GNAT_acetyltr_2 528 753 7e-103 PFAM
Pfam:tRNA_bind_2 771 892 3.6e-46 PFAM
low complexity region 999 1024 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000090447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151010
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an RNA cytidine acetyltransferase involved in histone acetylation, tRNA acetylation, the biosynthesis of 18S rRNA, and the enhancement of nuclear architecture and chromatin organization. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Atad2b A C 12: 5,018,053 H1017P probably damaging Het
Atp8a1 A T 5: 67,655,974 V943D probably benign Het
Babam1 C T 8: 71,404,307 A304V probably damaging Het
BC080695 C T 4: 143,571,897 R137C probably benign Het
Cdk5rap2 G T 4: 70,302,176 A584D probably damaging Het
Ddx21 A T 10: 62,591,837 L429* probably null Het
Dsp T C 13: 38,196,784 Y2502H probably damaging Het
Eaf1 G A 14: 31,504,376 D206N probably benign Het
Fam43b T A 4: 138,395,967 D14V possibly damaging Het
Fanca T A 8: 123,318,150 K34I probably damaging Het
Fzd4 T C 7: 89,407,317 Y191H probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10479 A G 12: 20,433,342 T55A probably damaging Het
Gsr T G 8: 33,697,256 I488M probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Myh13 T C 11: 67,341,551 M517T possibly damaging Het
Naip1 C G 13: 100,444,283 G152A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nin A G 12: 70,038,601 S1619P probably damaging Het
Olfr1036 A G 2: 86,075,579 I280V probably benign Het
Olfr297 G A 7: 86,526,761 M1I probably null Het
Pcdh15 A G 10: 74,643,607 T448A probably benign Het
Pcolce2 A G 9: 95,637,877 probably null Het
Pnp C T 14: 50,950,923 R207* probably null Het
Ppl A G 16: 5,089,446 V995A probably damaging Het
Ppp2r2a G A 14: 67,038,957 T33I probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rgs16 G T 1: 153,742,035 C97F probably damaging Het
Sacs T A 14: 61,207,268 D2254E probably benign Het
Slc6a17 T C 3: 107,474,281 M495V probably benign Het
Svep1 T C 4: 58,082,724 I1967V probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tcp11l2 A G 10: 84,584,936 D13G probably damaging Het
Vmn1r167 T C 7: 23,505,586 I2V probably benign Het
Vwa5a T C 9: 38,727,114 probably null Het
Wdr95 T C 5: 149,581,814 probably benign Het
Other mutations in Nat10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00570:Nat10 APN 2 103725764 critical splice acceptor site probably null
IGL01062:Nat10 APN 2 103743048 missense probably damaging 1.00
IGL01524:Nat10 APN 2 103757757 missense probably damaging 1.00
IGL02553:Nat10 APN 2 103752668 missense probably damaging 1.00
IGL03040:Nat10 APN 2 103757265 splice site probably benign
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0106:Nat10 UTSW 2 103757205 missense probably damaging 1.00
R0268:Nat10 UTSW 2 103727917 splice site probably benign
R0422:Nat10 UTSW 2 103726729 nonsense probably null
R0423:Nat10 UTSW 2 103748227 missense probably damaging 0.98
R0788:Nat10 UTSW 2 103743115 missense probably damaging 1.00
R0946:Nat10 UTSW 2 103731374 missense probably damaging 0.99
R1353:Nat10 UTSW 2 103754073 missense possibly damaging 0.95
R2141:Nat10 UTSW 2 103731303 splice site probably null
R2142:Nat10 UTSW 2 103731303 splice site probably null
R2192:Nat10 UTSW 2 103726177 missense probably benign 0.00
R3904:Nat10 UTSW 2 103726247 splice site probably benign
R4183:Nat10 UTSW 2 103739813 missense probably damaging 1.00
R4496:Nat10 UTSW 2 103757739 missense probably damaging 1.00
R4578:Nat10 UTSW 2 103754072 missense probably damaging 1.00
R4589:Nat10 UTSW 2 103754070 missense probably damaging 1.00
R4679:Nat10 UTSW 2 103732170 missense probably damaging 1.00
R4711:Nat10 UTSW 2 103748267 nonsense probably null
R5089:Nat10 UTSW 2 103757143 unclassified probably benign
R5103:Nat10 UTSW 2 103757260 missense probably damaging 0.97
R5108:Nat10 UTSW 2 103732203 missense probably damaging 0.97
R5134:Nat10 UTSW 2 103743293 missense probably benign 0.29
R5823:Nat10 UTSW 2 103730267 missense probably damaging 1.00
R5893:Nat10 UTSW 2 103721839 unclassified probably benign
R6135:Nat10 UTSW 2 103743316 missense probably damaging 1.00
R6455:Nat10 UTSW 2 103739886 missense possibly damaging 0.69
R6592:Nat10 UTSW 2 103754150 missense probably null 1.00
R6956:Nat10 UTSW 2 103734412 missense probably benign 0.01
R7036:Nat10 UTSW 2 103754108 missense probably benign 0.00
R7063:Nat10 UTSW 2 103748077 missense probably benign 0.01
R7172:Nat10 UTSW 2 103732969 missense probably damaging 1.00
R7226:Nat10 UTSW 2 103726753 missense probably benign 0.01
R7286:Nat10 UTSW 2 103754169 missense probably benign 0.02
R7448:Nat10 UTSW 2 103748045 missense probably damaging 0.99
R7470:Nat10 UTSW 2 103734881 missense probably benign 0.00
R7639:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7640:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7641:Nat10 UTSW 2 103743090 missense probably damaging 1.00
R7642:Nat10 UTSW 2 103726786 missense possibly damaging 0.94
R7766:Nat10 UTSW 2 103725707 missense probably benign 0.00
R7787:Nat10 UTSW 2 103721863 missense unknown
R7910:Nat10 UTSW 2 103725145 missense probably benign 0.26
R7991:Nat10 UTSW 2 103725145 missense probably benign 0.26
X0024:Nat10 UTSW 2 103727881 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TGTGGCTCAAGAATGTCAAGGG -3'
(R):5'- GCTATGCTTGCTGGAAGTTCAG -3'

Sequencing Primer
(F):5'- CCTACCCATGTTTTAGAGTAAGGACC -3'
(R):5'- GTTCAGATTAGAGAGGCCGTC -3'
Posted On2015-10-08