Mutagenetix > Incidental Mutations

Incidental Mutation 'R4639:Cdk5rap2'

350821

Institutional Source

Beutler Lab

Gene Symbol

Cdk5rap2

Ensembl Gene

ENSMUSG00000039298

Gene Name

CDK5 regulatory subunit associated protein 2

Synonyms

2900018K03Rik, an

MMRRC Submission

041901-MU

Accession Numbers

Genbank: NM_145990.3

Is this an essential gene?

Possibly essential (E-score: 0.538) question?

Stock #

R4639 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

70216856-70410443 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 70302176 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 584 (A584D)

Ref Sequence

ENSEMBL: ENSMUSP00000119891 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076541] [ENSMUST00000144099]

Predicted Effect

probably benign
Transcript: ENSMUST00000076541

Predicted Effect

probably damaging
Transcript: ENSMUST00000144099
AA Change: A584D

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000119891
Gene: ENSMUSG00000039298
AA Change: A584D

Domain	Start	End	E-Value	Type
Pfam:Cnn_1N	58	130	3.6e-26	PFAM
coiled coil region	210	345	N/A	INTRINSIC
low complexity region	368	381	N/A	INTRINSIC
coiled coil region	388	462	N/A	INTRINSIC
coiled coil region	569	616	N/A	INTRINSIC
low complexity region	761	776	N/A	INTRINSIC
low complexity region	791	800	N/A	INTRINSIC
coiled coil region	960	1001	N/A	INTRINSIC
coiled coil region	1112	1140	N/A	INTRINSIC
coiled coil region	1200	1237	N/A	INTRINSIC
Blast:BRLZ	1479	1535	6e-13	BLAST
low complexity region	1548	1565	N/A	INTRINSIC
low complexity region	1619	1637	N/A	INTRINSIC
low complexity region	1700	1711	N/A	INTRINSIC
low complexity region	1811	1822	N/A	INTRINSIC

Meta Mutation Damage Score

0.0874

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a regulator of CDK5 (cyclin-dependent kinase 5) activity. The protein encoded by this gene is localized to the centrosome and Golgi complex, interacts with CDK5R1 and pericentrin (PCNT), plays a role in centriole engagement and microtubule nucleation, and has been linked to primary microcephaly and Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Homozygous mutant phenotype varies by strain background. Severely affected mutants exhibit small size, severe anemia, and neonatal death. Mildly affected mutants are viable with mild macrocytic anemia, reduced fertility and radiation senstitivity. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, other(1) Gene trapped(20) Radiation induced(1)

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts16	G	A	13: 70,779,518		probably benign	Het
Atad2b	A	C	12: 5,018,053	H1017P	probably damaging	Het
Atp8a1	A	T	5: 67,655,974	V943D	probably benign	Het
Babam1	C	T	8: 71,404,307	A304V	probably damaging	Het
BC080695	C	T	4: 143,571,897	R137C	probably benign	Het
Ddx21	A	T	10: 62,591,837	L429*	probably null	Het
Dsp	T	C	13: 38,196,784	Y2502H	probably damaging	Het
Eaf1	G	A	14: 31,504,376	D206N	probably benign	Het
Fam43b	T	A	4: 138,395,967	D14V	possibly damaging	Het
Fanca	T	A	8: 123,318,150	K34I	probably damaging	Het
Fzd4	T	C	7: 89,407,317	Y191H	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm10479	A	G	12: 20,433,342	T55A	probably damaging	Het
Gsr	T	G	8: 33,697,256	I488M	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Myh13	T	C	11: 67,341,551	M517T	possibly damaging	Het
Naip1	C	G	13: 100,444,283	G152A	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nat10	G	A	2: 103,734,889	T449I	probably benign	Het
Nin	A	G	12: 70,038,601	S1619P	probably damaging	Het
Olfr1036	A	G	2: 86,075,579	I280V	probably benign	Het
Olfr297	G	A	7: 86,526,761	M1I	probably null	Het
Pcdh15	A	G	10: 74,643,607	T448A	probably benign	Het
Pcolce2	A	G	9: 95,637,877		probably null	Het
Pnp	C	T	14: 50,950,923	R207*	probably null	Het
Ppl	A	G	16: 5,089,446	V995A	probably damaging	Het
Ppp2r2a	G	A	14: 67,038,957	T33I	probably damaging	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
Rgs16	G	T	1: 153,742,035	C97F	probably damaging	Het
Sacs	T	A	14: 61,207,268	D2254E	probably benign	Het
Slc6a17	T	C	3: 107,474,281	M495V	probably benign	Het
Svep1	T	C	4: 58,082,724	I1967V	probably benign	Het
Sympk	G	T	7: 19,043,460	R545L	possibly damaging	Het
Tcp11l2	A	G	10: 84,584,936	D13G	probably damaging	Het
Vmn1r167	T	C	7: 23,505,586	I2V	probably benign	Het
Vwa5a	T	C	9: 38,727,114		probably null	Het
Wdr95	T	C	5: 149,581,814		probably benign	Het

Other mutations in Cdk5rap2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00425:Cdk5rap2	APN	4	70403472	critical splice donor site	probably null
IGL01305:Cdk5rap2	APN	4	70380235	missense	possibly damaging	0.52
IGL01987:Cdk5rap2	APN	4	70302082	critical splice donor site	probably null
IGL02213:Cdk5rap2	APN	4	70317602	splice site	probably benign
IGL02732:Cdk5rap2	APN	4	70266665	nonsense	probably null
IGL03063:Cdk5rap2	APN	4	70354877	critical splice acceptor site	probably null
IGL03244:Cdk5rap2	APN	4	70281435	missense	probably benign	0.19
ANU22:Cdk5rap2	UTSW	4	70380235	missense	possibly damaging	0.52
F5426:Cdk5rap2	UTSW	4	70254803	missense	probably benign
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0010:Cdk5rap2	UTSW	4	70243459	missense	probably benign	0.01
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0044:Cdk5rap2	UTSW	4	70360901	missense	probably damaging	1.00
R0482:Cdk5rap2	UTSW	4	70410269	start gained	probably benign
R0548:Cdk5rap2	UTSW	4	70349142	critical splice donor site	probably null
R0594:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R0737:Cdk5rap2	UTSW	4	70337375	missense	probably benign	0.01
R0788:Cdk5rap2	UTSW	4	70307231	missense	possibly damaging	0.90
R0960:Cdk5rap2	UTSW	4	70243508	missense	probably benign	0.03
R1682:Cdk5rap2	UTSW	4	70302150	missense	possibly damaging	0.92
R1727:Cdk5rap2	UTSW	4	70272679	missense	probably benign
R1727:Cdk5rap2	UTSW	4	70289972	missense	possibly damaging	0.70
R1768:Cdk5rap2	UTSW	4	70307233	missense	probably benign	0.09
R1903:Cdk5rap2	UTSW	4	70403554	splice site	probably null
R2270:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2271:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2272:Cdk5rap2	UTSW	4	70266678	missense	probably benign	0.01
R2364:Cdk5rap2	UTSW	4	70360809	critical splice donor site	probably null
R2763:Cdk5rap2	UTSW	4	70281271	missense	probably benign
R2893:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2894:Cdk5rap2	UTSW	4	70289873	missense	probably benign
R2958:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2959:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2961:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2962:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R2963:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3522:Cdk5rap2	UTSW	4	70250410	missense	probably damaging	1.00
R3725:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3726:Cdk5rap2	UTSW	4	70235437	missense	possibly damaging	0.89
R3876:Cdk5rap2	UTSW	4	70289977	frame shift	probably null
R3919:Cdk5rap2	UTSW	4	70380223	missense	possibly damaging	0.50
R4025:Cdk5rap2	UTSW	4	70250387	missense	probably damaging	0.98
R4324:Cdk5rap2	UTSW	4	70353614	missense	probably damaging	1.00
R4485:Cdk5rap2	UTSW	4	70239283	critical splice donor site	probably null
R4516:Cdk5rap2	UTSW	4	70276715	splice site	probably null
R4556:Cdk5rap2	UTSW	4	70239312	missense	probably damaging	0.97
R4560:Cdk5rap2	UTSW	4	70315331	missense	probably benign	0.03
R4584:Cdk5rap2	UTSW	4	70266760	missense	probably damaging	1.00
R4620:Cdk5rap2	UTSW	4	70266706	missense	probably benign	0.00
R4755:Cdk5rap2	UTSW	4	70238425	missense	probably damaging	1.00
R4947:Cdk5rap2	UTSW	4	70228592	splice site	probably null
R5116:Cdk5rap2	UTSW	4	70307238	missense	possibly damaging	0.67
R5449:Cdk5rap2	UTSW	4	70276651	missense	probably benign	0.00
R5643:Cdk5rap2	UTSW	4	70266733	missense	probably damaging	0.99
R5899:Cdk5rap2	UTSW	4	70243593	splice site	probably benign
R6177:Cdk5rap2	UTSW	4	70281482	missense	probably damaging	0.99
R6254:Cdk5rap2	UTSW	4	70364032	missense	probably damaging	1.00
R6326:Cdk5rap2	UTSW	4	70235454	missense	probably damaging	1.00
R6335:Cdk5rap2	UTSW	4	70266612	missense	possibly damaging	0.79
R6534:Cdk5rap2	UTSW	4	70354813	missense	probably damaging	0.98
R6857:Cdk5rap2	UTSW	4	70245396	nonsense	probably null
R6959:Cdk5rap2	UTSW	4	70360669	splice site	probably null
R7104:Cdk5rap2	UTSW	4	70349156	missense	probably benign	0.00
R7145:Cdk5rap2	UTSW	4	70238231	missense	probably benign	0.13
R7223:Cdk5rap2	UTSW	4	70235447	missense	probably benign	0.02
R7234:Cdk5rap2	UTSW	4	70376787	splice site	probably null
R7240:Cdk5rap2	UTSW	4	70291908	missense	probably damaging	1.00
R7247:Cdk5rap2	UTSW	4	70337429	missense	probably damaging	1.00
R7382:Cdk5rap2	UTSW	4	70290025	missense	probably benign	0.19
R7413:Cdk5rap2	UTSW	4	70254735	missense	probably damaging	1.00
R7576:Cdk5rap2	UTSW	4	70266872	missense	probably benign	0.01
R8236:Cdk5rap2	UTSW	4	70242485	missense	probably benign
R8434:Cdk5rap2	UTSW	4	70364020	missense	probably benign	0.00
Z1176:Cdk5rap2	UTSW	4	70266743	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TGGGGACATTCTACCTCTGG -3'
(R):5'- GGCATCGTGGCAATTCTTATTTCC -3'

Sequencing Primer
(F):5'- GACATTCTACCTCTGGTCTAGGG -3'
(R):5'- CCCAGATTTGCTAGGCTT -3'

Posted On

2015-10-08