Incidental Mutation 'R4639:BC080695'
ID350823
Institutional Source Beutler Lab
Gene Symbol BC080695
Ensembl Gene ENSMUSG00000070618
Gene NamecDNA sequence BC080695
Synonyms
MMRRC Submission 041901-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R4639 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location143551700-143573798 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 143571897 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 137 (R137C)
Ref Sequence ENSEMBL: ENSMUSP00000101400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105765] [ENSMUST00000105774]
Predicted Effect probably benign
Transcript: ENSMUST00000105765
AA Change: R137C

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101391
Gene: ENSMUSG00000070618
AA Change: R137C

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105774
AA Change: R137C

PolyPhen 2 Score 0.220 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101400
Gene: ENSMUSG00000070618
AA Change: R137C

DomainStartEndE-ValueType
SCOP:d1a4ya_ 210 414 5e-12 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Atad2b A C 12: 5,018,053 H1017P probably damaging Het
Atp8a1 A T 5: 67,655,974 V943D probably benign Het
Babam1 C T 8: 71,404,307 A304V probably damaging Het
Cdk5rap2 G T 4: 70,302,176 A584D probably damaging Het
Ddx21 A T 10: 62,591,837 L429* probably null Het
Dsp T C 13: 38,196,784 Y2502H probably damaging Het
Eaf1 G A 14: 31,504,376 D206N probably benign Het
Fam43b T A 4: 138,395,967 D14V possibly damaging Het
Fanca T A 8: 123,318,150 K34I probably damaging Het
Fzd4 T C 7: 89,407,317 Y191H probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gm10479 A G 12: 20,433,342 T55A probably damaging Het
Gsr T G 8: 33,697,256 I488M probably damaging Het
Mrs2 A G 13: 25,001,784 I135T probably damaging Het
Myh13 T C 11: 67,341,551 M517T possibly damaging Het
Naip1 C G 13: 100,444,283 G152A probably benign Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Nat10 G A 2: 103,734,889 T449I probably benign Het
Nin A G 12: 70,038,601 S1619P probably damaging Het
Olfr1036 A G 2: 86,075,579 I280V probably benign Het
Olfr297 G A 7: 86,526,761 M1I probably null Het
Pcdh15 A G 10: 74,643,607 T448A probably benign Het
Pcolce2 A G 9: 95,637,877 probably null Het
Pnp C T 14: 50,950,923 R207* probably null Het
Ppl A G 16: 5,089,446 V995A probably damaging Het
Ppp2r2a G A 14: 67,038,957 T33I probably damaging Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Rgs16 G T 1: 153,742,035 C97F probably damaging Het
Sacs T A 14: 61,207,268 D2254E probably benign Het
Slc6a17 T C 3: 107,474,281 M495V probably benign Het
Svep1 T C 4: 58,082,724 I1967V probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tcp11l2 A G 10: 84,584,936 D13G probably damaging Het
Vmn1r167 T C 7: 23,505,586 I2V probably benign Het
Vwa5a T C 9: 38,727,114 probably null Het
Wdr95 T C 5: 149,581,814 probably benign Het
Other mutations in BC080695
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02118:BC080695 APN 4 143571156 missense probably benign 0.42
IGL02533:BC080695 APN 4 143571002 utr 5 prime probably benign
R0352:BC080695 UTSW 4 143571308 splice site probably benign
R1600:BC080695 UTSW 4 143571967 missense possibly damaging 0.78
R3121:BC080695 UTSW 4 143571013 start codon destroyed probably null 1.00
R4005:BC080695 UTSW 4 143572269 missense probably benign 0.00
R4477:BC080695 UTSW 4 143571162 missense probably benign 0.21
R4791:BC080695 UTSW 4 143570989 start gained probably benign
R5118:BC080695 UTSW 4 143571127 missense probably damaging 1.00
R5353:BC080695 UTSW 4 143571237 missense probably benign 0.00
R5861:BC080695 UTSW 4 143571240 missense probably benign
R6163:BC080695 UTSW 4 143572035 missense probably damaging 1.00
R6286:BC080695 UTSW 4 143571226 missense probably benign
R6958:BC080695 UTSW 4 143571259 missense probably damaging 1.00
R7391:BC080695 UTSW 4 143572306 missense probably damaging 1.00
R7625:BC080695 UTSW 4 143572251 missense probably benign 0.00
R8189:BC080695 UTSW 4 143571960 missense probably benign
R8190:BC080695 UTSW 4 143571960 missense probably benign
R8192:BC080695 UTSW 4 143571960 missense probably benign
R8219:BC080695 UTSW 4 143571960 missense probably benign
R8221:BC080695 UTSW 4 143571960 missense probably benign
R8223:BC080695 UTSW 4 143571960 missense probably benign
R8226:BC080695 UTSW 4 143571960 missense probably benign
Z1176:BC080695 UTSW 4 143572252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGCTGACAAGAAAGATGCC -3'
(R):5'- TGCAATTCCAACTCCTCAATGC -3'

Sequencing Primer
(F):5'- TGCCTAGAAAAAGCTGGCTAATG -3'
(R):5'- CCAACTCCTCAATGCAATATGGTTGG -3'
Posted On2015-10-08