Mutagenetix > Incidental Mutations

Incidental Mutation 'R4639:Sympk'

350827

Institutional Source

Beutler Lab

Gene Symbol

Sympk

Ensembl Gene

ENSMUSG00000023118

Gene Name

symplekin

Synonyms

MMRRC Submission

041901-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R4639 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19024377-19054618 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 19043460 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 545 (R545L)

Ref Sequence

ENSEMBL: ENSMUSP00000023882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000023882
AA Change: R545L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: R545L

Domain	Start	End	E-Value	Type
low complexity region	106	118	N/A	INTRINSIC
Pfam:DUF3453	119	352	1.1e-63	PFAM
low complexity region	473	485	N/A	INTRINSIC
Pfam:Symplekin_C	887	1068	4.3e-78	PFAM
low complexity region	1123	1149	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138440

Predicted Effect

probably benign
Transcript: ENSMUST00000146903

SMART Domains

Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

Domain	Start	End	E-Value	Type
Pfam:DUF3453	117	230	1.1e-35	PFAM

Meta Mutation Damage Score

0.2518

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

97% (37/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adamts16	G	A	13: 70,779,518		probably benign	Het
Atad2b	A	C	12: 5,018,053	H1017P	probably damaging	Het
Atp8a1	A	T	5: 67,655,974	V943D	probably benign	Het
Babam1	C	T	8: 71,404,307	A304V	probably damaging	Het
BC080695	C	T	4: 143,571,897	R137C	probably benign	Het
Cdk5rap2	G	T	4: 70,302,176	A584D	probably damaging	Het
Ddx21	A	T	10: 62,591,837	L429*	probably null	Het
Dsp	T	C	13: 38,196,784	Y2502H	probably damaging	Het
Eaf1	G	A	14: 31,504,376	D206N	probably benign	Het
Fam43b	T	A	4: 138,395,967	D14V	possibly damaging	Het
Fanca	T	A	8: 123,318,150	K34I	probably damaging	Het
Fzd4	T	C	7: 89,407,317	Y191H	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gm10479	A	G	12: 20,433,342	T55A	probably damaging	Het
Gsr	T	G	8: 33,697,256	I488M	probably damaging	Het
Mrs2	A	G	13: 25,001,784	I135T	probably damaging	Het
Myh13	T	C	11: 67,341,551	M517T	possibly damaging	Het
Naip1	C	G	13: 100,444,283	G152A	probably benign	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Nat10	G	A	2: 103,734,889	T449I	probably benign	Het
Nin	A	G	12: 70,038,601	S1619P	probably damaging	Het
Olfr1036	A	G	2: 86,075,579	I280V	probably benign	Het
Olfr297	G	A	7: 86,526,761	M1I	probably null	Het
Pcdh15	A	G	10: 74,643,607	T448A	probably benign	Het
Pcolce2	A	G	9: 95,637,877		probably null	Het
Pnp	C	T	14: 50,950,923	R207*	probably null	Het
Ppl	A	G	16: 5,089,446	V995A	probably damaging	Het
Ppp2r2a	G	A	14: 67,038,957	T33I	probably damaging	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
Rgs16	G	T	1: 153,742,035	C97F	probably damaging	Het
Sacs	T	A	14: 61,207,268	D2254E	probably benign	Het
Slc6a17	T	C	3: 107,474,281	M495V	probably benign	Het
Svep1	T	C	4: 58,082,724	I1967V	probably benign	Het
Tcp11l2	A	G	10: 84,584,936	D13G	probably damaging	Het
Vmn1r167	T	C	7: 23,505,586	I2V	probably benign	Het
Vwa5a	T	C	9: 38,727,114		probably null	Het
Wdr95	T	C	5: 149,581,814		probably benign	Het

Other mutations in Sympk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01114:Sympk	APN	7	19047573	missense	probably benign	0.14
IGL01834:Sympk	APN	7	19043435	missense	probably benign	0.02
IGL02588:Sympk	APN	7	19042625	missense	probably benign
IGL02601:Sympk	APN	7	19048869	missense	probably benign	0.31
IGL02645:Sympk	APN	7	19052424	missense	probably damaging	0.99
IGL02698:Sympk	APN	7	19045634	missense	probably benign	0.35
IGL02709:Sympk	APN	7	19047538	missense	probably benign	0.26
IGL02814:Sympk	APN	7	19053273	missense	probably damaging	1.00
IGL03198:Sympk	APN	7	19044996	missense	possibly damaging	0.92
butterfinger	UTSW	7	19048453	missense	probably damaging	0.98
fifth_avenue	UTSW	7	19043460	missense	possibly damaging	0.83
IGL02991:Sympk	UTSW	7	19030577	missense	probably damaging	1.00
R0391:Sympk	UTSW	7	19046849	missense	probably benign	0.06
R1036:Sympk	UTSW	7	19048453	missense	probably damaging	0.98
R1872:Sympk	UTSW	7	19029145	missense	probably benign
R2058:Sympk	UTSW	7	19043529	missense	probably damaging	1.00
R2103:Sympk	UTSW	7	19054116	missense	probably benign
R2966:Sympk	UTSW	7	19030544	missense	probably damaging	1.00
R3110:Sympk	UTSW	7	19034484	missense	possibly damaging	0.69
R3112:Sympk	UTSW	7	19034484	missense	possibly damaging	0.69
R3703:Sympk	UTSW	7	19040561	missense	probably damaging	0.99
R3775:Sympk	UTSW	7	19035955	missense	probably damaging	1.00
R3930:Sympk	UTSW	7	19047522	missense	possibly damaging	0.90
R4638:Sympk	UTSW	7	19043460	missense	possibly damaging	0.83
R4645:Sympk	UTSW	7	19043460	missense	possibly damaging	0.83
R4688:Sympk	UTSW	7	19054410	missense	probably benign
R5050:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5051:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5052:Sympk	UTSW	7	19036042	missense	probably benign	0.19
R5092:Sympk	UTSW	7	19042659	missense	probably benign	0.17
R5211:Sympk	UTSW	7	19035889	missense	probably benign	0.22
R5591:Sympk	UTSW	7	19054039	missense	probably damaging	1.00
R5678:Sympk	UTSW	7	19049472	critical splice donor site	probably null
R5972:Sympk	UTSW	7	19046824	missense	probably benign
R6387:Sympk	UTSW	7	19052498	missense	possibly damaging	0.94
R6543:Sympk	UTSW	7	19036830	missense	probably damaging	1.00
R6984:Sympk	UTSW	7	19038043	missense	probably benign	0.00
R7141:Sympk	UTSW	7	19054092	missense	probably benign
R7292:Sympk	UTSW	7	19036030	missense	probably benign	0.01
R7319:Sympk	UTSW	7	19035845	missense	probably benign
R7887:Sympk	UTSW	7	19034439	missense	possibly damaging	0.69
R8094:Sympk	UTSW	7	19053448	critical splice donor site	probably null
R8147:Sympk	UTSW	7	19036793	missense	probably damaging	0.98
R8409:Sympk	UTSW	7	19052438	missense	probably benign	0.11
RF064:Sympk	UTSW	7	19034395	frame shift	probably null
X0017:Sympk	UTSW	7	19040663	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- TACTGCAAGCCCTGTTCAGC -3'
(R):5'- GCTAAGGGCTAGTACCACAG -3'

Sequencing Primer
(F):5'- GAGACACACTCCATGGCAG -3'
(R):5'- GGGCTAGTACCACAGGAACTTTTC -3'

Posted On

2015-10-08