Incidental Mutation 'R4639:Dsp'
ID 350845
Institutional Source Beutler Lab
Gene Symbol Dsp
Ensembl Gene ENSMUSG00000054889
Gene Name desmoplakin
Synonyms DP, 2300002E22Rik, 5730453H04Rik, rul
MMRRC Submission 041901-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4639 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 38335270-38382553 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 38380760 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 2502 (Y2502H)
Ref Sequence ENSEMBL: ENSMUSP00000115062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124830] [ENSMUST00000127906]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000124830
AA Change: Y2502H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115062
Gene: ENSMUSG00000054889
AA Change: Y2502H

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-96 BLAST
Blast:SPEC 783 894 4e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1370 N/A INTRINSIC
coiled coil region 1394 1956 N/A INTRINSIC
low complexity region 1997 2011 N/A INTRINSIC
PLEC 2021 2057 3.33e-1 SMART
PLEC 2058 2095 3.76e-9 SMART
PLEC 2096 2133 4.09e-10 SMART
PLEC 2134 2171 2.09e-7 SMART
PLEC 2175 2209 4.83e1 SMART
PLEC 2210 2245 5.67e1 SMART
PLEC 2263 2300 1.22e-8 SMART
PLEC 2301 2338 1.16e-9 SMART
PLEC 2339 2376 1.12e-7 SMART
PLEC 2377 2414 1.56e-6 SMART
PLEC 2418 2452 1.42e0 SMART
PLEC 2468 2505 3.7e-8 SMART
low complexity region 2507 2517 N/A INTRINSIC
PLEC 2519 2556 3.73e-4 SMART
low complexity region 2577 2593 N/A INTRINSIC
PLEC 2622 2659 1.46e-6 SMART
PLEC 2660 2697 6.69e-15 SMART
PLEC 2698 2735 1.98e2 SMART
PLEC 2736 2773 2.35e-10 SMART
PLEC 2774 2811 1.39e-3 SMART
low complexity region 2835 2860 N/A INTRINSIC
low complexity region 2867 2879 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000127906
AA Change: Y1903H

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000117252
Gene: ENSMUSG00000054889
AA Change: Y1903H

DomainStartEndE-ValueType
Blast:SPEC 193 282 2e-51 BLAST
SPEC 285 385 6.03e-2 SMART
Blast:SPEC 391 557 1e-95 BLAST
Blast:SPEC 783 894 3e-34 BLAST
SPEC 901 1030 1.39e0 SMART
coiled coil region 1033 1357 N/A INTRINSIC
low complexity region 1398 1412 N/A INTRINSIC
PLEC 1422 1458 3.33e-1 SMART
PLEC 1459 1496 3.76e-9 SMART
PLEC 1497 1534 4.09e-10 SMART
PLEC 1535 1572 2.09e-7 SMART
PLEC 1576 1610 4.83e1 SMART
PLEC 1611 1646 5.67e1 SMART
PLEC 1664 1701 1.22e-8 SMART
PLEC 1702 1739 1.16e-9 SMART
PLEC 1740 1777 1.12e-7 SMART
PLEC 1778 1815 1.56e-6 SMART
PLEC 1819 1853 1.42e0 SMART
PLEC 1869 1906 3.7e-8 SMART
low complexity region 1908 1918 N/A INTRINSIC
PLEC 1920 1957 3.73e-4 SMART
low complexity region 1978 1994 N/A INTRINSIC
PLEC 2023 2060 1.46e-6 SMART
PLEC 2061 2098 6.69e-15 SMART
PLEC 2099 2136 1.98e2 SMART
PLEC 2137 2174 2.35e-10 SMART
PLEC 2175 2212 1.39e-3 SMART
low complexity region 2236 2261 N/A INTRINSIC
low complexity region 2268 2280 N/A INTRINSIC
Meta Mutation Damage Score 0.0751 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that anchors intermediate filaments to desmosomal plaques and forms an obligate component of functional desmosomes. Mutations in this gene are the cause of several cardiomyopathies and keratodermas, including skin fragility-woolly hair syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous targeted null mutants die by embryonic day E6.5 due to instability of desmosomes and tissue integrity; rescue by aggregation with wild-type tetraploid morulae increase embyronic survival with noted major defects in heart muscle, neuroepithelium and epidermis; conditional knockouts that are epidermal-specific have compositionally altered epidermal desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Atad2b A C 12: 5,068,053 (GRCm39) H1017P probably damaging Het
Atp8a1 A T 5: 67,813,317 (GRCm39) V943D probably benign Het
Babam1 C T 8: 71,856,951 (GRCm39) A304V probably damaging Het
Cdk5rap2 G T 4: 70,220,413 (GRCm39) A584D probably damaging Het
Ddx21 A T 10: 62,427,616 (GRCm39) L429* probably null Het
Eaf1 G A 14: 31,226,333 (GRCm39) D206N probably benign Het
Fam43b T A 4: 138,123,278 (GRCm39) D14V possibly damaging Het
Fanca T A 8: 124,044,889 (GRCm39) K34I probably damaging Het
Fzd4 T C 7: 89,056,525 (GRCm39) Y191H probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gm10479 A G 12: 20,483,343 (GRCm39) T55A probably damaging Het
Gsr T G 8: 34,187,284 (GRCm39) I488M probably damaging Het
Mrs2 A G 13: 25,185,767 (GRCm39) I135T probably damaging Het
Myh13 T C 11: 67,232,377 (GRCm39) M517T possibly damaging Het
Naip1 C G 13: 100,580,791 (GRCm39) G152A probably benign Het
Naip5 T A 13: 100,356,338 (GRCm39) E1092D probably benign Het
Nat10 G A 2: 103,565,234 (GRCm39) T449I probably benign Het
Nin A G 12: 70,085,375 (GRCm39) S1619P probably damaging Het
Or14c45 G A 7: 86,175,969 (GRCm39) M1I probably null Het
Or5m9b A G 2: 85,905,923 (GRCm39) I280V probably benign Het
Pcdh15 A G 10: 74,479,439 (GRCm39) T448A probably benign Het
Pcolce2 A G 9: 95,519,930 (GRCm39) probably null Het
Pnp C T 14: 51,188,380 (GRCm39) R207* probably null Het
Ppl A G 16: 4,907,310 (GRCm39) V995A probably damaging Het
Ppp2r2a G A 14: 67,276,406 (GRCm39) T33I probably damaging Het
Pramel20 C T 4: 143,298,467 (GRCm39) R137C probably benign Het
Pyroxd1 C G 6: 142,300,467 (GRCm39) S199* probably null Het
Rgs16 G T 1: 153,617,781 (GRCm39) C97F probably damaging Het
Sacs T A 14: 61,444,717 (GRCm39) D2254E probably benign Het
Slc6a17 T C 3: 107,381,597 (GRCm39) M495V probably benign Het
Svep1 T C 4: 58,082,724 (GRCm39) I1967V probably benign Het
Sympk G T 7: 18,777,385 (GRCm39) R545L possibly damaging Het
Tcp11l2 A G 10: 84,420,800 (GRCm39) D13G probably damaging Het
Vmn1r167 T C 7: 23,205,011 (GRCm39) I2V probably benign Het
Vwa5a T C 9: 38,638,410 (GRCm39) probably null Het
Wdr95 T C 5: 149,505,279 (GRCm39) probably benign Het
Other mutations in Dsp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Dsp APN 13 38,381,822 (GRCm39) missense probably damaging 0.99
IGL01337:Dsp APN 13 38,376,663 (GRCm39) missense probably benign 0.44
IGL01371:Dsp APN 13 38,377,593 (GRCm39) missense probably benign 0.13
IGL01473:Dsp APN 13 38,351,547 (GRCm39) missense probably damaging 0.99
IGL01660:Dsp APN 13 38,360,471 (GRCm39) missense possibly damaging 0.90
IGL01723:Dsp APN 13 38,363,060 (GRCm39) missense probably damaging 1.00
IGL01999:Dsp APN 13 38,365,162 (GRCm39) missense probably damaging 0.99
IGL02313:Dsp APN 13 38,380,499 (GRCm39) nonsense probably null
IGL02833:Dsp APN 13 38,376,897 (GRCm39) missense possibly damaging 0.56
IGL03050:Dsp APN 13 38,372,421 (GRCm39) splice site probably benign
IGL03353:Dsp APN 13 38,370,671 (GRCm39) missense probably damaging 1.00
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0052:Dsp UTSW 13 38,381,340 (GRCm39) missense possibly damaging 0.93
R0078:Dsp UTSW 13 38,379,993 (GRCm39) missense probably benign 0.22
R0230:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign 0.03
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0234:Dsp UTSW 13 38,371,869 (GRCm39) missense probably benign 0.13
R0285:Dsp UTSW 13 38,356,770 (GRCm39) missense probably benign
R0326:Dsp UTSW 13 38,376,846 (GRCm39) nonsense probably null
R0332:Dsp UTSW 13 38,366,204 (GRCm39) nonsense probably null
R0471:Dsp UTSW 13 38,377,326 (GRCm39) nonsense probably null
R0567:Dsp UTSW 13 38,376,414 (GRCm39) missense probably benign 0.01
R0611:Dsp UTSW 13 38,371,717 (GRCm39) missense probably damaging 1.00
R0718:Dsp UTSW 13 38,380,740 (GRCm39) missense possibly damaging 0.80
R0926:Dsp UTSW 13 38,367,194 (GRCm39) missense probably damaging 0.97
R1078:Dsp UTSW 13 38,367,082 (GRCm39) splice site probably benign
R1183:Dsp UTSW 13 38,375,716 (GRCm39) nonsense probably null
R1188:Dsp UTSW 13 38,378,939 (GRCm39) missense probably damaging 1.00
R1419:Dsp UTSW 13 38,370,671 (GRCm39) missense probably damaging 1.00
R1445:Dsp UTSW 13 38,375,907 (GRCm39) missense probably damaging 0.98
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1467:Dsp UTSW 13 38,376,688 (GRCm39) missense probably benign 0.00
R1478:Dsp UTSW 13 38,365,114 (GRCm39) missense probably damaging 1.00
R1568:Dsp UTSW 13 38,359,123 (GRCm39) missense probably damaging 1.00
R1572:Dsp UTSW 13 38,379,714 (GRCm39) missense probably damaging 1.00
R1676:Dsp UTSW 13 38,377,350 (GRCm39) nonsense probably null
R1736:Dsp UTSW 13 38,376,966 (GRCm39) missense probably benign 0.01
R1776:Dsp UTSW 13 38,380,593 (GRCm39) missense probably damaging 0.99
R1829:Dsp UTSW 13 38,377,171 (GRCm39) missense probably damaging 1.00
R1878:Dsp UTSW 13 38,348,831 (GRCm39) missense possibly damaging 0.53
R2013:Dsp UTSW 13 38,375,434 (GRCm39) missense probably damaging 1.00
R2161:Dsp UTSW 13 38,380,427 (GRCm39) missense probably damaging 1.00
R2187:Dsp UTSW 13 38,360,383 (GRCm39) missense probably damaging 1.00
R2295:Dsp UTSW 13 38,381,022 (GRCm39) missense probably benign 0.28
R2495:Dsp UTSW 13 38,377,453 (GRCm39) missense possibly damaging 0.91
R2566:Dsp UTSW 13 38,380,380 (GRCm39) missense probably damaging 1.00
R2888:Dsp UTSW 13 38,376,224 (GRCm39) missense possibly damaging 0.92
R3012:Dsp UTSW 13 38,377,318 (GRCm39) missense possibly damaging 0.61
R3614:Dsp UTSW 13 38,361,175 (GRCm39) missense probably damaging 0.98
R3725:Dsp UTSW 13 38,381,594 (GRCm39) missense probably benign 0.00
R3725:Dsp UTSW 13 38,378,665 (GRCm39) splice site probably null
R3797:Dsp UTSW 13 38,361,260 (GRCm39) critical splice donor site probably null
R3841:Dsp UTSW 13 38,381,681 (GRCm39) missense probably benign
R4030:Dsp UTSW 13 38,375,404 (GRCm39) missense possibly damaging 0.84
R4124:Dsp UTSW 13 38,370,689 (GRCm39) missense probably damaging 1.00
R4279:Dsp UTSW 13 38,369,207 (GRCm39) missense probably damaging 1.00
R4334:Dsp UTSW 13 38,380,640 (GRCm39) missense possibly damaging 0.46
R4419:Dsp UTSW 13 38,379,108 (GRCm39) missense probably damaging 1.00
R4615:Dsp UTSW 13 38,375,608 (GRCm39) missense probably damaging 0.98
R4627:Dsp UTSW 13 38,352,617 (GRCm39) missense probably benign 0.01
R4687:Dsp UTSW 13 38,375,595 (GRCm39) missense probably damaging 1.00
R4735:Dsp UTSW 13 38,380,016 (GRCm39) missense probably damaging 0.99
R4746:Dsp UTSW 13 38,379,080 (GRCm39) missense possibly damaging 0.51
R4772:Dsp UTSW 13 38,351,504 (GRCm39) nonsense probably null
R4830:Dsp UTSW 13 38,376,840 (GRCm39) missense probably benign
R4850:Dsp UTSW 13 38,376,445 (GRCm39) missense probably damaging 1.00
R4959:Dsp UTSW 13 38,375,686 (GRCm39) missense probably benign 0.41
R4963:Dsp UTSW 13 38,381,846 (GRCm39) missense probably damaging 0.99
R4969:Dsp UTSW 13 38,376,886 (GRCm39) missense probably benign 0.00
R4978:Dsp UTSW 13 38,366,210 (GRCm39) missense probably damaging 1.00
R4989:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5068:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5069:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5070:Dsp UTSW 13 38,381,099 (GRCm39) missense possibly damaging 0.78
R5133:Dsp UTSW 13 38,381,678 (GRCm39) missense possibly damaging 0.93
R5138:Dsp UTSW 13 38,379,821 (GRCm39) missense possibly damaging 0.50
R5138:Dsp UTSW 13 38,367,274 (GRCm39) missense probably benign 0.37
R5153:Dsp UTSW 13 38,366,282 (GRCm39) missense probably damaging 1.00
R5199:Dsp UTSW 13 38,376,878 (GRCm39) nonsense probably null
R5226:Dsp UTSW 13 38,370,746 (GRCm39) missense probably damaging 0.99
R5265:Dsp UTSW 13 38,379,159 (GRCm39) missense possibly damaging 0.95
R5371:Dsp UTSW 13 38,378,865 (GRCm39) missense probably damaging 0.97
R5484:Dsp UTSW 13 38,368,014 (GRCm39) missense possibly damaging 0.48
R5534:Dsp UTSW 13 38,379,818 (GRCm39) missense probably benign 0.01
R5569:Dsp UTSW 13 38,376,628 (GRCm39) missense probably benign 0.01
R5854:Dsp UTSW 13 38,351,477 (GRCm39) splice site probably null
R5910:Dsp UTSW 13 38,376,445 (GRCm39) missense possibly damaging 0.95
R5929:Dsp UTSW 13 38,379,410 (GRCm39) missense possibly damaging 0.92
R5940:Dsp UTSW 13 38,380,002 (GRCm39) missense possibly damaging 0.70
R5948:Dsp UTSW 13 38,379,377 (GRCm39) missense possibly damaging 0.95
R5955:Dsp UTSW 13 38,378,934 (GRCm39) missense possibly damaging 0.73
R5970:Dsp UTSW 13 38,379,678 (GRCm39) missense possibly damaging 0.93
R6054:Dsp UTSW 13 38,351,585 (GRCm39) missense probably benign 0.00
R6113:Dsp UTSW 13 38,376,023 (GRCm39) missense probably damaging 1.00
R6139:Dsp UTSW 13 38,376,382 (GRCm39) missense probably damaging 0.97
R6328:Dsp UTSW 13 38,380,982 (GRCm39) nonsense probably null
R6527:Dsp UTSW 13 38,379,849 (GRCm39) missense probably damaging 1.00
R6573:Dsp UTSW 13 38,380,838 (GRCm39) missense probably damaging 1.00
R6628:Dsp UTSW 13 38,351,598 (GRCm39) missense possibly damaging 0.73
R6738:Dsp UTSW 13 38,376,186 (GRCm39) missense possibly damaging 0.87
R6898:Dsp UTSW 13 38,376,193 (GRCm39) missense possibly damaging 0.59
R6919:Dsp UTSW 13 38,351,631 (GRCm39) missense possibly damaging 0.84
R6951:Dsp UTSW 13 38,351,622 (GRCm39) missense possibly damaging 0.95
R7017:Dsp UTSW 13 38,370,683 (GRCm39) missense probably benign 0.02
R7022:Dsp UTSW 13 38,375,716 (GRCm39) missense probably benign 0.06
R7135:Dsp UTSW 13 38,363,049 (GRCm39) missense probably damaging 1.00
R7192:Dsp UTSW 13 38,379,569 (GRCm39) missense probably benign 0.09
R7211:Dsp UTSW 13 38,372,511 (GRCm39) critical splice donor site probably null
R7251:Dsp UTSW 13 38,377,524 (GRCm39) missense probably benign 0.02
R7326:Dsp UTSW 13 38,376,859 (GRCm39) missense probably benign 0.01
R7369:Dsp UTSW 13 38,381,501 (GRCm39) missense possibly damaging 0.82
R7376:Dsp UTSW 13 38,356,819 (GRCm39) missense probably damaging 1.00
R7406:Dsp UTSW 13 38,381,172 (GRCm39) missense possibly damaging 0.63
R7439:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7439:Dsp UTSW 13 38,360,478 (GRCm39) critical splice donor site probably null
R7441:Dsp UTSW 13 38,379,425 (GRCm39) missense probably benign 0.00
R7477:Dsp UTSW 13 38,356,839 (GRCm39) missense probably damaging 1.00
R7535:Dsp UTSW 13 38,376,765 (GRCm39) missense probably benign 0.05
R7558:Dsp UTSW 13 38,352,742 (GRCm39) missense probably benign 0.02
R7600:Dsp UTSW 13 38,375,691 (GRCm39) missense probably damaging 1.00
R7616:Dsp UTSW 13 38,375,458 (GRCm39) missense probably damaging 0.98
R7702:Dsp UTSW 13 38,359,183 (GRCm39) missense possibly damaging 0.83
R7738:Dsp UTSW 13 38,369,151 (GRCm39) missense probably damaging 0.97
R7815:Dsp UTSW 13 38,375,446 (GRCm39) missense probably benign 0.31
R7882:Dsp UTSW 13 38,367,994 (GRCm39) missense possibly damaging 0.76
R7917:Dsp UTSW 13 38,351,615 (GRCm39) nonsense probably null
R7971:Dsp UTSW 13 38,376,499 (GRCm39) missense probably damaging 0.97
R8104:Dsp UTSW 13 38,352,600 (GRCm39) missense probably benign 0.03
R8176:Dsp UTSW 13 38,376,786 (GRCm39) missense possibly damaging 0.56
R8303:Dsp UTSW 13 38,381,319 (GRCm39) missense probably benign
R8323:Dsp UTSW 13 38,356,806 (GRCm39) missense possibly damaging 0.80
R8326:Dsp UTSW 13 38,375,611 (GRCm39) missense probably damaging 1.00
R8358:Dsp UTSW 13 38,376,457 (GRCm39) missense possibly damaging 0.92
R8410:Dsp UTSW 13 38,380,791 (GRCm39) missense possibly damaging 0.94
R8552:Dsp UTSW 13 38,369,117 (GRCm39) missense probably damaging 0.98
R8713:Dsp UTSW 13 38,352,701 (GRCm39) missense probably damaging 0.99
R8801:Dsp UTSW 13 38,381,502 (GRCm39) missense possibly damaging 0.81
R8900:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8901:Dsp UTSW 13 38,365,155 (GRCm39) missense probably damaging 0.99
R8968:Dsp UTSW 13 38,335,596 (GRCm39) missense possibly damaging 0.83
R9014:Dsp UTSW 13 38,376,700 (GRCm39) missense possibly damaging 0.83
R9021:Dsp UTSW 13 38,380,808 (GRCm39) missense possibly damaging 0.61
R9030:Dsp UTSW 13 38,352,673 (GRCm39) missense probably damaging 1.00
R9124:Dsp UTSW 13 38,377,276 (GRCm39) missense probably benign 0.42
R9129:Dsp UTSW 13 38,377,126 (GRCm39) missense probably benign 0.09
R9143:Dsp UTSW 13 38,377,337 (GRCm39) missense probably benign 0.05
R9450:Dsp UTSW 13 38,376,379 (GRCm39) missense probably damaging 1.00
R9488:Dsp UTSW 13 38,377,218 (GRCm39) missense probably benign 0.04
R9514:Dsp UTSW 13 38,371,781 (GRCm39) missense probably benign 0.02
R9789:Dsp UTSW 13 38,367,937 (GRCm39) missense probably benign 0.03
R9792:Dsp UTSW 13 38,379,494 (GRCm39) missense possibly damaging 0.87
X0023:Dsp UTSW 13 38,381,660 (GRCm39) missense probably benign 0.00
X0024:Dsp UTSW 13 38,377,231 (GRCm39) missense probably benign 0.04
X0027:Dsp UTSW 13 38,370,622 (GRCm39) missense possibly damaging 0.68
X0067:Dsp UTSW 13 38,366,288 (GRCm39) missense possibly damaging 0.85
Z1176:Dsp UTSW 13 38,381,166 (GRCm39) missense possibly damaging 0.81
Z1177:Dsp UTSW 13 38,376,830 (GRCm39) frame shift probably null
Z1177:Dsp UTSW 13 38,335,665 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TCACCTATCTGCAACTGAAGGAG -3'
(R):5'- AAACTGTGTGAGGCTAAGGC -3'

Sequencing Primer
(F):5'- CCTATCTGCAACTGAAGGAGAGATG -3'
(R):5'- CCTGATCGGTATTGATCGAAGAAC -3'
Posted On 2015-10-08