Incidental Mutation 'R4608:Kif21b'
ID350856
Institutional Source Beutler Lab
Gene Symbol Kif21b
Ensembl Gene ENSMUSG00000041642
Gene Namekinesin family member 21B
SynonymsN-5 kinesin, 2610511N21Rik
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136131389-136177998 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 136148186 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075164] [ENSMUST00000130864]
Predicted Effect probably benign
Transcript: ENSMUST00000075164
SMART Domains Protein: ENSMUSP00000074661
Gene: ENSMUSG00000041642

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 3.81e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122892
Predicted Effect probably benign
Transcript: ENSMUST00000130864
SMART Domains Protein: ENSMUSP00000114297
Gene: ENSMUSG00000041642

DomainStartEndE-ValueType
KISc 6 379 6.39e-159 SMART
Blast:KISc 469 543 1e-14 BLAST
low complexity region 578 628 N/A INTRINSIC
coiled coil region 632 825 N/A INTRINSIC
low complexity region 847 866 N/A INTRINSIC
coiled coil region 931 991 N/A INTRINSIC
low complexity region 1109 1123 N/A INTRINSIC
low complexity region 1239 1249 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
WD40 1299 1336 2.89e-5 SMART
WD40 1339 1377 5.69e-4 SMART
WD40 1404 1441 6.42e-1 SMART
WD40 1444 1486 1.5e-3 SMART
WD40 1494 1532 4.8e-2 SMART
WD40 1535 1575 1.55e-5 SMART
WD40 1578 1615 5.1e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily. Kinesins are ATP-dependent microtubule-based motor proteins that are involved in the intracellular transport of membranous organelles. Single nucleotide polymorphisms in this gene are associated with inflammatory bowel disease and multiple sclerosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]
PHENOTYPE: Homozygous KO reduces dendrite branching and spine density as a result of reduced microtubule growth, resulting in impaired spatial learning and cued conditioning behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Kif21b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Kif21b APN 1 136152342 missense possibly damaging 0.68
IGL01020:Kif21b APN 1 136154094 splice site probably benign
IGL01288:Kif21b APN 1 136172184 missense probably benign 0.00
IGL02105:Kif21b APN 1 136171303 missense probably benign
IGL02264:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02303:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02308:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02310:Kif21b APN 1 136159757 missense probably damaging 1.00
IGL02419:Kif21b APN 1 136151267 missense probably benign 0.00
IGL02553:Kif21b APN 1 136154121 missense probably damaging 1.00
IGL02568:Kif21b APN 1 136172867 missense probably damaging 0.96
IGL02657:Kif21b APN 1 136172230 missense possibly damaging 0.88
IGL03068:Kif21b APN 1 136158355 unclassified probably benign
IGL03230:Kif21b APN 1 136162812 missense probably benign 0.03
R0190:Kif21b UTSW 1 136171219 missense probably benign 0.32
R0349:Kif21b UTSW 1 136149311 missense probably damaging 0.97
R0501:Kif21b UTSW 1 136163099 missense probably benign 0.44
R0620:Kif21b UTSW 1 136159428 missense possibly damaging 0.88
R0629:Kif21b UTSW 1 136172157 critical splice acceptor site probably null
R0741:Kif21b UTSW 1 136159744 missense probably damaging 1.00
R1087:Kif21b UTSW 1 136162823 missense probably damaging 1.00
R1217:Kif21b UTSW 1 136152376 missense probably damaging 1.00
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1464:Kif21b UTSW 1 136156153 missense possibly damaging 0.50
R1511:Kif21b UTSW 1 136169324 critical splice donor site probably null
R1512:Kif21b UTSW 1 136152805 missense probably benign 0.01
R1513:Kif21b UTSW 1 136156111 missense probably damaging 0.98
R1591:Kif21b UTSW 1 136149317 missense probably damaging 1.00
R1616:Kif21b UTSW 1 136171685 missense probably damaging 1.00
R1628:Kif21b UTSW 1 136171220 missense probably benign 0.01
R1658:Kif21b UTSW 1 136171285 missense probably damaging 1.00
R1728:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1741:Kif21b UTSW 1 136156142 missense probably damaging 1.00
R1784:Kif21b UTSW 1 136160121 missense possibly damaging 0.85
R1807:Kif21b UTSW 1 136147793 missense possibly damaging 0.94
R1896:Kif21b UTSW 1 136147845 missense possibly damaging 0.90
R1970:Kif21b UTSW 1 136171156 missense probably damaging 1.00
R1984:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1985:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1986:Kif21b UTSW 1 136147546 missense probably damaging 1.00
R1988:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R1990:Kif21b UTSW 1 136161770 missense probably damaging 1.00
R2014:Kif21b UTSW 1 136148282 missense probably damaging 1.00
R2045:Kif21b UTSW 1 136160313 missense probably damaging 1.00
R2141:Kif21b UTSW 1 136152264 missense probably damaging 0.98
R2248:Kif21b UTSW 1 136172966 missense probably damaging 1.00
R2886:Kif21b UTSW 1 136147874 splice site probably benign
R2896:Kif21b UTSW 1 136154217 missense possibly damaging 0.82
R3706:Kif21b UTSW 1 136159410 missense probably benign 0.06
R3780:Kif21b UTSW 1 136156226 missense probably damaging 0.99
R3827:Kif21b UTSW 1 136162994 critical splice donor site probably null
R4227:Kif21b UTSW 1 136154093 splice site probably null
R4600:Kif21b UTSW 1 136147864 missense probably benign 0.39
R4749:Kif21b UTSW 1 136144749 nonsense probably null
R4841:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4842:Kif21b UTSW 1 136145220 missense probably damaging 1.00
R4933:Kif21b UTSW 1 136151325 splice site probably null
R4959:Kif21b UTSW 1 136148370 missense possibly damaging 0.90
R5018:Kif21b UTSW 1 136172234 missense probably benign 0.30
R5116:Kif21b UTSW 1 136152783 missense probably damaging 0.99
R5119:Kif21b UTSW 1 136163100 missense probably benign
R5197:Kif21b UTSW 1 136144625 missense probably damaging 1.00
R5230:Kif21b UTSW 1 136171673 missense probably damaging 1.00
R5249:Kif21b UTSW 1 136169228 missense probably damaging 1.00
R5337:Kif21b UTSW 1 136171143 missense probably damaging 1.00
R5358:Kif21b UTSW 1 136172292 missense possibly damaging 0.85
R5466:Kif21b UTSW 1 136147525 missense probably damaging 1.00
R5557:Kif21b UTSW 1 136170059 missense probably damaging 1.00
R5727:Kif21b UTSW 1 136170009 missense probably damaging 1.00
R5865:Kif21b UTSW 1 136151137 nonsense probably null
R5929:Kif21b UTSW 1 136151207 missense probably damaging 1.00
R6274:Kif21b UTSW 1 136149418 missense possibly damaging 0.57
R6349:Kif21b UTSW 1 136158326 missense probably damaging 1.00
R6648:Kif21b UTSW 1 136152397 missense probably benign 0.00
R6831:Kif21b UTSW 1 136144758 nonsense probably null
R7156:Kif21b UTSW 1 136147824 missense probably damaging 1.00
R7165:Kif21b UTSW 1 136149448 missense probably damaging 0.98
R7327:Kif21b UTSW 1 136159649 missense possibly damaging 0.60
R7680:Kif21b UTSW 1 136147869 critical splice donor site probably null
RF024:Kif21b UTSW 1 136158341 missense probably damaging 1.00
X0053:Kif21b UTSW 1 136149316 missense probably damaging 1.00
X0066:Kif21b UTSW 1 136172945 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGGCTTGTCTCTATCTCTCAG -3'
(R):5'- TGATGGAGATGCCCTCTTTG -3'

Sequencing Primer
(F):5'- TCTCGTCTCATCCATGCAATG -3'
(R):5'- CTCTTTGGCCCGTTCGC -3'
Posted On2015-10-08