Incidental Mutation 'R4608:Eif4g3'
ID350869
Institutional Source Beutler Lab
Gene Symbol Eif4g3
Ensembl Gene ENSMUSG00000028760
Gene Nameeukaryotic translation initiation factor 4 gamma, 3
Synonyms1500002J22Rik, repro8, G1-419-52, 4930523M17Rik, eIF4GII
MMRRC Submission 041819-MU
Accession Numbers

Genbank: NM_172703; MGI: 1923935

Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location137993022-138208508 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 138126458 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 618 (R618L)
Ref Sequence ENSEMBL: ENSMUSP00000145147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084214] [ENSMUST00000084215] [ENSMUST00000105830] [ENSMUST00000105831] [ENSMUST00000203828]
Predicted Effect probably benign
Transcript: ENSMUST00000084214
AA Change: R453L

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000081232
Gene: ENSMUSG00000028760
AA Change: R453L

DomainStartEndE-ValueType
low complexity region 24 43 N/A INTRINSIC
low complexity region 93 120 N/A INTRINSIC
low complexity region 147 152 N/A INTRINSIC
PDB:1LJ2|D 154 179 8e-9 PDB
low complexity region 192 207 N/A INTRINSIC
low complexity region 269 310 N/A INTRINSIC
low complexity region 427 444 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
low complexity region 579 588 N/A INTRINSIC
low complexity region 592 616 N/A INTRINSIC
Blast:MIF4G 617 708 5e-49 BLAST
Blast:MIF4G 722 765 5e-16 BLAST
MIF4G 768 996 1.42e-65 SMART
low complexity region 1086 1109 N/A INTRINSIC
MA3 1215 1327 9.29e-38 SMART
eIF5C 1487 1574 7.92e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084215
AA Change: R435L

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000081233
Gene: ENSMUSG00000028760
AA Change: R435L

DomainStartEndE-ValueType
low complexity region 10 25 N/A INTRINSIC
low complexity region 75 102 N/A INTRINSIC
low complexity region 129 134 N/A INTRINSIC
PDB:1LJ2|D 136 161 8e-9 PDB
low complexity region 174 189 N/A INTRINSIC
low complexity region 251 292 N/A INTRINSIC
low complexity region 409 426 N/A INTRINSIC
low complexity region 516 532 N/A INTRINSIC
low complexity region 561 570 N/A INTRINSIC
low complexity region 574 598 N/A INTRINSIC
Blast:MIF4G 599 690 4e-49 BLAST
Blast:MIF4G 704 747 5e-16 BLAST
MIF4G 750 978 1.42e-65 SMART
low complexity region 1068 1113 N/A INTRINSIC
MA3 1216 1328 9.29e-38 SMART
eIF5C 1488 1575 7.92e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105830
AA Change: R445L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101456
Gene: ENSMUSG00000028760
AA Change: R445L

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 86 113 N/A INTRINSIC
low complexity region 140 145 N/A INTRINSIC
PDB:1LJ2|D 147 172 1e-7 PDB
low complexity region 261 302 N/A INTRINSIC
low complexity region 419 436 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105831
AA Change: R442L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101457
Gene: ENSMUSG00000028760
AA Change: R442L

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
low complexity region 82 109 N/A INTRINSIC
low complexity region 136 141 N/A INTRINSIC
PDB:1LJ2|D 143 168 8e-9 PDB
low complexity region 181 196 N/A INTRINSIC
low complexity region 258 299 N/A INTRINSIC
low complexity region 416 433 N/A INTRINSIC
low complexity region 523 539 N/A INTRINSIC
low complexity region 568 577 N/A INTRINSIC
low complexity region 581 605 N/A INTRINSIC
Blast:MIF4G 606 697 4e-49 BLAST
Blast:MIF4G 711 754 5e-16 BLAST
MIF4G 757 985 1.42e-65 SMART
low complexity region 1075 1098 N/A INTRINSIC
MA3 1204 1316 9.29e-38 SMART
eIF5C 1476 1563 7.92e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000203828
AA Change: R618L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000145147
Gene: ENSMUSG00000028760
AA Change: R618L

DomainStartEndE-ValueType
low complexity region 41 81 N/A INTRINSIC
low complexity region 193 208 N/A INTRINSIC
low complexity region 258 285 N/A INTRINSIC
low complexity region 312 317 N/A INTRINSIC
PDB:1LJ2|D 319 344 9e-9 PDB
low complexity region 357 372 N/A INTRINSIC
low complexity region 434 475 N/A INTRINSIC
low complexity region 592 609 N/A INTRINSIC
low complexity region 699 715 N/A INTRINSIC
low complexity region 744 753 N/A INTRINSIC
low complexity region 757 781 N/A INTRINSIC
Blast:MIF4G 782 873 9e-49 BLAST
Blast:MIF4G 887 930 5e-16 BLAST
MIF4G 933 1161 6e-68 SMART
coiled coil region 1174 1201 N/A INTRINSIC
low complexity region 1251 1296 N/A INTRINSIC
MA3 1399 1511 3.9e-40 SMART
eIF5C 1671 1758 3.9e-38 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be part of the eIF4F protein complex, which is involved in mRNA cap recognition and transport of mRNAs to the ribosome. Interestingly, a microRNA (miR-520c-3p) has been found that negatively regulates synthesis of the encoded protein, and this leads to a global decrease in protein translation and cell proliferation. Therefore, this protein is a key component of the anti-tumor activity of miR-520c-3p. [provided by RefSeq, May 2016]
PHENOTYPE: Mice homozygous for an ENU induced allele exhibit decreased testes weight, azoospermia, and arrested male meiosis. Mice homozygous for a gene trapped allele exhibit small testes. [provided by MGI curators]
Allele List at MGI

All alleles(27) : Gene trapped(27)

Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Eif4g3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01817:Eif4g3 APN 4 138120362 missense probably benign 0.01
IGL02171:Eif4g3 APN 4 138126589 missense probably benign 0.03
IGL02487:Eif4g3 APN 4 138203378 missense possibly damaging 0.92
IGL02514:Eif4g3 APN 4 138126194 missense possibly damaging 0.87
IGL02622:Eif4g3 APN 4 138097366 splice site probably benign
IGL02725:Eif4g3 APN 4 138170471 splice site probably benign
IGL02735:Eif4g3 APN 4 138126211 missense probably benign 0.40
IGL03008:Eif4g3 APN 4 138120388 missense probably damaging 1.00
IGL03077:Eif4g3 APN 4 138125855 missense probably damaging 1.00
N/A - 535:Eif4g3 UTSW 4 138120428 missense probably damaging 0.98
R0013:Eif4g3 UTSW 4 138175848 missense possibly damaging 0.88
R0193:Eif4g3 UTSW 4 138146376 splice site probably benign
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0240:Eif4g3 UTSW 4 138170562 missense probably damaging 0.98
R0563:Eif4g3 UTSW 4 138175840 splice site probably benign
R0841:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R0884:Eif4g3 UTSW 4 138151776 missense possibly damaging 0.76
R1116:Eif4g3 UTSW 4 138091775 critical splice donor site probably null
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1145:Eif4g3 UTSW 4 138165818 missense probably damaging 1.00
R1192:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R1401:Eif4g3 UTSW 4 138206084 missense probably damaging 0.99
R1535:Eif4g3 UTSW 4 138097302 missense probably damaging 1.00
R1571:Eif4g3 UTSW 4 138120408 missense probably damaging 1.00
R1576:Eif4g3 UTSW 4 138096870 missense probably damaging 0.99
R1607:Eif4g3 UTSW 4 138126563 missense probably benign 0.00
R1618:Eif4g3 UTSW 4 138206058 missense probably damaging 1.00
R1793:Eif4g3 UTSW 4 138171131 missense probably damaging 1.00
R1823:Eif4g3 UTSW 4 138180491 missense probably benign 0.37
R1857:Eif4g3 UTSW 4 138175876 missense possibly damaging 0.67
R1907:Eif4g3 UTSW 4 138158415 missense probably damaging 1.00
R2041:Eif4g3 UTSW 4 138105306 splice site probably benign
R2106:Eif4g3 UTSW 4 138082919 start gained probably benign
R2124:Eif4g3 UTSW 4 138184742 missense probably damaging 1.00
R2301:Eif4g3 UTSW 4 138172659 missense probably damaging 1.00
R2519:Eif4g3 UTSW 4 138097318 missense probably benign 0.37
R3033:Eif4g3 UTSW 4 138103410 missense probably damaging 1.00
R3870:Eif4g3 UTSW 4 138096900 missense probably damaging 0.98
R4542:Eif4g3 UTSW 4 138203417 missense probably damaging 0.99
R4582:Eif4g3 UTSW 4 138171245 missense probably damaging 1.00
R4607:Eif4g3 UTSW 4 138126458 missense probably benign 0.03
R4658:Eif4g3 UTSW 4 138206132 missense probably damaging 1.00
R4736:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4739:Eif4g3 UTSW 4 138183199 missense possibly damaging 0.79
R4739:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4740:Eif4g3 UTSW 4 138198097 missense probably benign 0.01
R4760:Eif4g3 UTSW 4 138084318 missense possibly damaging 0.46
R4825:Eif4g3 UTSW 4 138194081 missense probably benign
R4826:Eif4g3 UTSW 4 138177945 missense possibly damaging 0.95
R4941:Eif4g3 UTSW 4 138170565 missense probably damaging 1.00
R5040:Eif4g3 UTSW 4 138096889 missense probably damaging 0.99
R5070:Eif4g3 UTSW 4 138146299 missense probably benign 0.00
R5155:Eif4g3 UTSW 4 138126743 missense probably benign 0.36
R5226:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5229:Eif4g3 UTSW 4 138096794 missense possibly damaging 0.93
R5303:Eif4g3 UTSW 4 138126562 missense probably benign 0.04
R5369:Eif4g3 UTSW 4 138183334 missense possibly damaging 0.87
R5394:Eif4g3 UTSW 4 138103398 unclassified probably null
R5665:Eif4g3 UTSW 4 138126589 missense probably benign 0.03
R5678:Eif4g3 UTSW 4 138151742 missense probably damaging 0.99
R5695:Eif4g3 UTSW 4 138163433 splice site probably null
R5704:Eif4g3 UTSW 4 138190692 missense probably damaging 1.00
R5924:Eif4g3 UTSW 4 138201926 missense probably damaging 1.00
R6214:Eif4g3 UTSW 4 138058003 missense probably damaging 0.99
R6278:Eif4g3 UTSW 4 138188083 missense possibly damaging 0.82
R6519:Eif4g3 UTSW 4 137994008 missense probably benign
R6659:Eif4g3 UTSW 4 138177932 missense probably damaging 1.00
R6720:Eif4g3 UTSW 4 138175832 intron probably null
R6812:Eif4g3 UTSW 4 138103376 missense probably damaging 1.00
R6922:Eif4g3 UTSW 4 138097335 missense probably damaging 1.00
R7175:Eif4g3 UTSW 4 138126215 missense probably damaging 1.00
R7176:Eif4g3 UTSW 4 138171186 missense probably damaging 1.00
R7598:Eif4g3 UTSW 4 138194124 missense probably benign 0.02
R7618:Eif4g3 UTSW 4 138171118 missense probably damaging 1.00
R7805:Eif4g3 UTSW 4 138146354 missense probably benign 0.00
RF008:Eif4g3 UTSW 4 138175924 missense probably damaging 0.98
X0067:Eif4g3 UTSW 4 138163619 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTAGCGCCTCATGATAGTCAGC -3'
(R):5'- GGCTCCTTCCTGAATGTAGG -3'

Sequencing Primer
(F):5'- CAGGAAGTGCTGCCATTGACTC -3'
(R):5'- CCTTCCTGAATGTAGGCTCTGG -3'
Posted On2015-10-08