Incidental Mutation 'R4608:P2ry6'
ID350886
Institutional Source Beutler Lab
Gene Symbol P2ry6
Ensembl Gene ENSMUSG00000048779
Gene Namepyrimidinergic receptor P2Y, G-protein coupled, 6
SynonymsP2Y6, 2010204J23Rik
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location100937630-100974649 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100938304 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 283 (Y283H)
Ref Sequence ENSEMBL: ENSMUSP00000055697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060174]
Predicted Effect probably damaging
Transcript: ENSMUST00000060174
AA Change: Y283H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055697
Gene: ENSMUSG00000048779
AA Change: Y283H

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 33 270 2.6e-6 PFAM
Pfam:7tm_1 43 301 1.1e-43 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209196
Meta Mutation Damage Score 0.7179 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the family of P2 receptors, which is activated by extracellular nucleotides and subdivided into P2X ligand-gated ion channels and P2Y G-protein coupled receptors. This family has several receptor subtypes with different pharmacological selectivity, which overlaps in some cases, for various adenosine and uridine nucleotides. This receptor, which is a G-protein coupled receptor, is responsive to UDP, partially responsive to UTP and ADP, and not responsive to ATP. It is proposed that this receptor mediates inflammatory responses. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal macrophage, endothelial, and vascular smooth muscle response to UTP and UDP. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in P2ry6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02095:P2ry6 APN 7 100938864 missense probably damaging 1.00
R0195:P2ry6 UTSW 7 100938697 missense probably damaging 1.00
R1669:P2ry6 UTSW 7 100938423 missense probably damaging 0.99
R1688:P2ry6 UTSW 7 100938384 missense probably damaging 1.00
R4607:P2ry6 UTSW 7 100938304 missense probably damaging 1.00
R6027:P2ry6 UTSW 7 100938508 missense probably benign
R6320:P2ry6 UTSW 7 100938396 missense probably damaging 1.00
R6490:P2ry6 UTSW 7 100938373 missense probably damaging 1.00
R7582:P2ry6 UTSW 7 100938577 missense probably damaging 1.00
X0066:P2ry6 UTSW 7 100938981 missense probably benign 0.00
Z1177:P2ry6 UTSW 7 100938283 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACACATTGCAGCCAGTG -3'
(R):5'- CTTGTTATTGTCGCATGGCC -3'

Sequencing Primer
(F):5'- CAGCCAGTGCCCCAGGG -3'
(R):5'- CTGTGTCGCCAGGATGG -3'
Posted On2015-10-08