Incidental Mutation 'R4608:Xab2'
ID350890
Institutional Source Beutler Lab
Gene Symbol Xab2
Ensembl Gene ENSMUSG00000019470
Gene NameXPA binding protein 2
Synonyms0610041O14Rik
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location3608421-3621316 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3618105 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 158 (S158P)
Ref Sequence ENSEMBL: ENSMUSP00000019614 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019614] [ENSMUST00000156380] [ENSMUST00000159235] [ENSMUST00000207389] [ENSMUST00000207428] [ENSMUST00000208950]
Predicted Effect probably benign
Transcript: ENSMUST00000019614
AA Change: S158P

PolyPhen 2 Score 0.232 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000019614
Gene: ENSMUSG00000019470
AA Change: S158P

DomainStartEndE-ValueType
HAT 48 80 7.56e0 SMART
HAT 93 122 1.92e2 SMART
HAT 124 158 4.89e-2 SMART
HAT 270 305 3.82e-4 SMART
low complexity region 316 333 N/A INTRINSIC
HAT 409 445 1.88e1 SMART
HAT 447 496 2.32e2 SMART
HAT 498 530 1.56e1 SMART
HAT 532 566 5.84e0 SMART
HAT 571 605 3.62e-5 SMART
Blast:HAT 607 641 3e-14 BLAST
Blast:HAT 643 677 2e-15 BLAST
HAT 679 713 2.77e-1 SMART
low complexity region 771 785 N/A INTRINSIC
low complexity region 823 836 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122654
Predicted Effect probably benign
Transcript: ENSMUST00000156380
SMART Domains Protein: ENSMUSP00000137626
Gene: ENSMUSG00000087687

DomainStartEndE-ValueType
Pfam:DUF2346 1 72 2.2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159235
SMART Domains Protein: ENSMUSP00000124237
Gene: ENSMUSG00000019470

DomainStartEndE-ValueType
Blast:HAT 12 47 2e-13 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000159548
AA Change: S155P
SMART Domains Protein: ENSMUSP00000124202
Gene: ENSMUSG00000019470
AA Change: S155P

DomainStartEndE-ValueType
Blast:HAT 10 44 4e-12 BLAST
HAT 46 78 7.56e0 SMART
HAT 91 120 1.92e2 SMART
HAT 122 156 4.89e-2 SMART
Blast:HAT 157 190 4e-12 BLAST
Pfam:TPR_2 243 272 2.2e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163038
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207257
Predicted Effect probably benign
Transcript: ENSMUST00000207389
Predicted Effect probably benign
Transcript: ENSMUST00000207428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208185
Predicted Effect probably benign
Transcript: ENSMUST00000208950
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype PHENOTYPE: Homozygous null embryos die by the blastocyst stage (E3.5) and some eight-cell stage embryos do not undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Itih4 G A 14: 30,901,669 G915R probably damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Xab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00924:Xab2 APN 8 3611723 missense probably damaging 1.00
IGL01308:Xab2 APN 8 3616332 missense probably benign 0.07
IGL01324:Xab2 APN 8 3621232 missense possibly damaging 0.80
IGL01340:Xab2 APN 8 3614381 missense probably damaging 1.00
IGL01613:Xab2 APN 8 3610880 missense probably benign 0.01
IGL02622:Xab2 APN 8 3611699 missense probably benign 0.01
IGL02809:Xab2 APN 8 3610175 missense probably benign 0.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0066:Xab2 UTSW 8 3613880 missense probably damaging 1.00
R0544:Xab2 UTSW 8 3610994 missense probably damaging 1.00
R0607:Xab2 UTSW 8 3613605 missense probably benign 0.05
R0735:Xab2 UTSW 8 3613649 missense possibly damaging 0.50
R0943:Xab2 UTSW 8 3613667 missense probably benign 0.00
R1507:Xab2 UTSW 8 3616031 missense possibly damaging 0.93
R1664:Xab2 UTSW 8 3619068 unclassified probably null
R1954:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R1955:Xab2 UTSW 8 3616094 missense probably damaging 0.96
R3767:Xab2 UTSW 8 3619053 missense probably damaging 1.00
R4399:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4421:Xab2 UTSW 8 3614244 critical splice donor site probably null
R4440:Xab2 UTSW 8 3616353 missense probably benign 0.01
R4553:Xab2 UTSW 8 3611015 missense probably benign 0.00
R4580:Xab2 UTSW 8 3610162 missense probably damaging 1.00
R4707:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R5522:Xab2 UTSW 8 3611718 missense probably benign 0.06
R6063:Xab2 UTSW 8 3613051 missense possibly damaging 0.93
R6273:Xab2 UTSW 8 3611822 missense probably damaging 1.00
R6487:Xab2 UTSW 8 3613879 missense possibly damaging 0.75
R7140:Xab2 UTSW 8 3618117 missense possibly damaging 0.92
R7648:Xab2 UTSW 8 3610638 missense probably benign 0.00
R7767:Xab2 UTSW 8 3619018 missense probably benign 0.08
Z1176:Xab2 UTSW 8 3618969 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACCTATTCATCGGAGCCTC -3'
(R):5'- CAGGTGATGACCCCTATTGC -3'

Sequencing Primer
(F):5'- ATCGGAGCCTCTTCCTGCAG -3'
(R):5'- CCCTGTGCCCTAGATATGAAGTG -3'
Posted On2015-10-08