Incidental Mutation 'R0268:Trim65'
Institutional Source Beutler Lab
Gene Symbol Trim65
Ensembl Gene ENSMUSG00000054517
Gene Nametripartite motif-containing 65
MMRRC Submission 038494-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0268 (G1)
Quality Score127
Status Validated
Chromosomal Location116121846-116131128 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 116126644 bp
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000102048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067632] [ENSMUST00000106440]
Predicted Effect probably benign
Transcript: ENSMUST00000067632
SMART Domains Protein: ENSMUSP00000063410
Gene: ENSMUSG00000054517

RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 3e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Pfam:SPRY 386 505 1.5e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106440
SMART Domains Protein: ENSMUSP00000102048
Gene: ENSMUSG00000054517

RING 13 51 2.47e-9 SMART
low complexity region 69 85 N/A INTRINSIC
Blast:BBOX 94 132 2e-10 BLAST
coiled coil region 140 175 N/A INTRINSIC
low complexity region 282 298 N/A INTRINSIC
PRY 333 383 3.67e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133039
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154061
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 95.9%
  • 20x: 93.0%
Validation Efficiency 98% (93/95)
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik T A 7: 29,574,602 noncoding transcript Het
5430419D17Rik A G 7: 131,238,176 D609G probably damaging Het
Aadacl4 A T 4: 144,622,995 H274L probably benign Het
Aldh1a7 T A 19: 20,709,502 probably null Het
Ap3m1 A C 14: 21,037,102 probably benign Het
Atp5a1 C A 18: 77,780,195 N356K probably damaging Het
AU021092 A T 16: 5,222,167 M31K possibly damaging Het
Avpr1a T C 10: 122,449,709 V302A probably damaging Het
Bicral A G 17: 46,814,052 probably benign Het
Btbd9 C T 17: 30,274,942 D492N possibly damaging Het
Casp8ap2 A T 4: 32,644,079 I1051F probably damaging Het
Cd209e T C 8: 3,849,125 I196V probably benign Het
Cdc42bpa G T 1: 180,155,782 probably benign Het
Clec16a T A 16: 10,644,828 L670* probably null Het
Cmtm2b A G 8: 104,322,434 E27G probably damaging Het
Col4a1 T A 8: 11,267,588 probably benign Het
Cyp26b1 A T 6: 84,574,572 F221I probably damaging Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dennd6b T C 15: 89,196,229 Q56R probably benign Het
Dip2c G A 13: 9,637,150 R1270H probably damaging Het
Dlg1 T C 16: 31,684,193 C73R probably benign Het
Dnah8 A G 17: 30,769,707 D3217G probably damaging Het
Dtx1 T C 5: 120,681,291 E614G probably damaging Het
Dut C A 2: 125,257,091 A166E probably damaging Het
Ebf1 C A 11: 44,643,413 D166E probably damaging Het
Egln2 A T 7: 27,165,247 D84E possibly damaging Het
Exosc7 T A 9: 123,118,960 S65T probably benign Het
Fam83e G A 7: 45,726,910 R349Q probably benign Het
Fbxl17 G A 17: 63,385,067 probably benign Het
Fras1 A G 5: 96,737,009 N2582S probably damaging Het
Fubp1 T C 3: 152,219,713 V164A probably damaging Het
Gfral A T 9: 76,197,101 C210S probably damaging Het
Gm13084 A T 4: 143,810,768 I331N probably damaging Het
Hcn4 A C 9: 58,860,162 E1002A unknown Het
Hcrtr2 A G 9: 76,228,188 V449A probably benign Het
Hectd1 C A 12: 51,769,107 S1394I probably damaging Het
Hectd1 T C 12: 51,769,108 S1394G possibly damaging Het
Hecw2 A G 1: 53,926,698 probably benign Het
Herc3 A G 6: 58,868,628 probably benign Het
Ipo4 T C 14: 55,625,942 Q1073R possibly damaging Het
Itsn2 G A 12: 4,700,333 R1199Q probably benign Het
Kcnj3 C A 2: 55,594,959 Y356* probably null Het
Klb T A 5: 65,348,837 D142E probably benign Het
Klhl35 T A 7: 99,471,751 S409T probably benign Het
Krt16 T A 11: 100,246,525 probably benign Het
Krt82 C A 15: 101,541,713 R516L probably benign Het
Lce3a A T 3: 92,925,731 C21S unknown Het
Lims2 A G 18: 31,944,520 E103G probably benign Het
Map2 A T 1: 66,380,722 K71* probably null Het
Mthfr C G 4: 148,055,428 S618W probably damaging Het
Mycbp2 T A 14: 103,314,325 R157* probably null Het
Nat10 C A 2: 103,727,917 probably benign Het
Obscn G A 11: 59,067,272 T3810M possibly damaging Het
Olfr1161 A T 2: 88,025,468 I249F probably damaging Het
Olfr1354 C T 10: 78,917,605 T255I probably damaging Het
Olfr1375 T A 11: 51,048,941 M278K probably damaging Het
Olfr525 G A 7: 140,323,155 S152N possibly damaging Het
Olfr799 A T 10: 129,647,176 D16V possibly damaging Het
Olfr998 A G 2: 85,591,301 T254A possibly damaging Het
Park7 A G 4: 150,908,349 V20A possibly damaging Het
Pgm1 T A 5: 64,105,808 V266E probably damaging Het
Phip G A 9: 82,871,288 T1801I probably damaging Het
Pkhd1l1 C A 15: 44,597,011 H4205Q probably benign Het
Ppp1r12a T A 10: 108,273,381 probably benign Het
Ppp1r32 A G 19: 10,477,085 V329A possibly damaging Het
Ptprq A T 10: 107,705,548 D372E probably benign Het
Ptprr G A 10: 116,252,963 V340I possibly damaging Het
Qk A G 17: 10,209,646 probably benign Het
Qpct T A 17: 79,077,652 D240E probably benign Het
Ren1 A G 1: 133,355,611 T162A possibly damaging Het
Rif1 T C 2: 52,090,286 probably null Het
Sart3 A G 5: 113,752,399 V461A probably damaging Het
Scgb1b24 G A 7: 33,743,853 G19R probably null Het
Spen A T 4: 141,477,557 I1253N unknown Het
Sspo C A 6: 48,465,555 H1995N probably benign Het
Tfap2c A G 2: 172,551,503 T113A probably benign Het
Togaram2 T C 17: 71,697,998 probably null Het
Trpm3 T A 19: 22,897,521 probably null Het
Ubxn7 T C 16: 32,360,046 I87T probably benign Het
Vav1 T C 17: 57,296,090 F81L probably damaging Het
Vmn2r102 A G 17: 19,677,850 T376A probably benign Het
Vmn2r105 A T 17: 20,208,676 C713S probably benign Het
Zbtb45 C T 7: 13,008,327 M1I probably null Het
Zfp229 A T 17: 21,745,841 M351L probably benign Het
Zfp932 T C 5: 110,009,063 I176T probably benign Het
Zswim1 G A 2: 164,826,126 E433K probably damaging Het
Other mutations in Trim65
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Trim65 APN 11 116126509 missense probably damaging 1.00
PIT4531001:Trim65 UTSW 11 116127709 missense possibly damaging 0.85
R0105:Trim65 UTSW 11 116126066 makesense probably null
R0126:Trim65 UTSW 11 116124604 splice site probably benign
R0647:Trim65 UTSW 11 116128210 missense possibly damaging 0.92
R2234:Trim65 UTSW 11 116130677 missense possibly damaging 0.91
R2235:Trim65 UTSW 11 116130677 missense possibly damaging 0.91
R4011:Trim65 UTSW 11 116127703 missense probably benign 0.00
R4086:Trim65 UTSW 11 116126479 nonsense probably null
R4088:Trim65 UTSW 11 116126479 nonsense probably null
R4089:Trim65 UTSW 11 116126479 nonsense probably null
R4434:Trim65 UTSW 11 116127609 nonsense probably null
R5407:Trim65 UTSW 11 116126080 missense probably benign
R5947:Trim65 UTSW 11 116128282 missense probably damaging 0.99
R6299:Trim65 UTSW 11 116126551 missense probably benign 0.00
R7248:Trim65 UTSW 11 116127708 missense probably benign 0.01
R7336:Trim65 UTSW 11 116128290 missense probably benign 0.00
R7496:Trim65 UTSW 11 116126316 missense probably damaging 1.00
R7835:Trim65 UTSW 11 116130929 missense probably damaging 1.00
R7849:Trim65 UTSW 11 116126256 missense probably damaging 0.99
R7918:Trim65 UTSW 11 116130929 missense probably damaging 1.00
R7932:Trim65 UTSW 11 116126256 missense probably damaging 0.99
X0061:Trim65 UTSW 11 116126571 missense probably benign 0.39
X0066:Trim65 UTSW 11 116130846 missense probably benign 0.25
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- gccatgaggaattcaccagtaag -3'
Posted On2013-05-09