Incidental Mutation 'R4608:Itih4'
ID350910
Institutional Source Beutler Lab
Gene Symbol Itih4
Ensembl Gene ENSMUSG00000021922
Gene Nameinter alpha-trypsin inhibitor, heavy chain 4
SynonymsItih-4
MMRRC Submission 041819-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4608 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30886476-30902353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30901669 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 915 (G915R)
Ref Sequence ENSEMBL: ENSMUSP00000125920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006703] [ENSMUST00000078490] [ENSMUST00000120269] [ENSMUST00000168782]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006703
AA Change: G892R

PolyPhen 2 Score 0.836 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000006703
Gene: ENSMUSG00000021922
AA Change: G892R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 781 941 2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000078490
AA Change: G931R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077580
Gene: ENSMUSG00000021922
AA Change: G931R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 777 941 2.2e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120269
AA Change: G932R

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112798
Gene: ENSMUSG00000021922
AA Change: G932R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 738 902 6.5e-46 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134988
Predicted Effect probably damaging
Transcript: ENSMUST00000168782
AA Change: G915R

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125920
Gene: ENSMUSG00000021922
AA Change: G915R

DomainStartEndE-ValueType
VIT 19 148 3.22e-80 SMART
VWA 272 456 5.97e-30 SMART
coiled coil region 552 584 N/A INTRINSIC
low complexity region 662 690 N/A INTRINSIC
Pfam:ITI_HC_C 761 925 2.2e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227899
Meta Mutation Damage Score 0.8275 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (80/80)
MGI Phenotype FUNCTION: This gene encodes a member of the inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors with diverse functions as anti-apoptotic and matrix stabilizing molecules during development. This gene is predominantly expressed in the liver and the encoded protein was found to be a plasma kallikrein-sensitive glycoprotein. This gene is located in a cluster of related inter alpha trypsin inhibitor genes on chromosome 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and overtly normal. Surprisingly, IL-6/STAT3 signaling is significantly suppressed in mutant liver tissues but hepatocytes remain well differentiated. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930022D16Rik A G 11: 109,418,029 I74V unknown Het
Acss3 T A 10: 106,967,029 I452F possibly damaging Het
Adam10 T C 9: 70,743,891 L66P probably damaging Het
Adamts18 A T 8: 113,737,613 C738S probably damaging Het
Adamts7 T G 9: 90,174,540 S221A probably damaging Het
Adrm1 A G 2: 180,174,855 probably benign Het
Aqp1 T C 6: 55,336,639 V50A possibly damaging Het
Aqp4 T C 18: 15,398,126 I193V probably benign Het
B130006D01Rik A T 11: 95,726,240 probably benign Het
Bbs10 T G 10: 111,300,820 I598S probably damaging Het
Bbs10 A G 10: 111,301,134 K703E probably benign Het
Ccnl1 C T 3: 65,946,710 probably benign Het
Crocc2 G A 1: 93,168,794 V24M possibly damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dcdc2a T A 13: 25,061,240 L100* probably null Het
Eif4g3 G T 4: 138,126,458 R618L probably benign Het
F5 C T 1: 164,209,029 P1920S probably benign Het
Fam187b T A 7: 30,977,745 N226K probably benign Het
Fancc C A 13: 63,331,823 probably benign Het
Fastk G T 5: 24,443,119 P233H probably damaging Het
Fbn1 A C 2: 125,306,500 D2609E probably benign Het
Fes G A 7: 80,387,211 R42W probably damaging Het
Fmnl2 T A 2: 53,103,716 N374K possibly damaging Het
Fpgt G A 3: 155,086,696 Q565* probably null Het
Gckr A G 5: 31,307,797 D370G probably damaging Het
Ggt6 T C 11: 72,437,943 M385T probably benign Het
Gm26657 C A 4: 56,741,114 H100N probably benign Het
Gm6588 A G 5: 112,449,898 S104G possibly damaging Het
Gsg1l T A 7: 125,958,549 I136F probably damaging Het
Hhip C T 8: 79,997,563 R350Q probably damaging Het
Ints1 C T 5: 139,759,844 S1353N probably benign Het
Ints10 G A 8: 68,810,619 R394Q probably damaging Het
Ints6 T G 14: 62,703,229 R557S probably damaging Het
Ints9 T A 14: 65,032,280 I473N possibly damaging Het
Kif1a C A 1: 93,024,646 A1304S possibly damaging Het
Kif21b C T 1: 136,148,186 probably benign Het
Klk13 C A 7: 43,713,860 C10* probably null Het
Krtap4-8 C T 11: 99,780,495 probably benign Het
Lef1 T C 3: 131,184,733 S167P probably benign Het
Leng8 T A 7: 4,144,797 I607N probably damaging Het
Lrch4 T A 5: 137,639,146 L526* probably null Het
Memo1 G A 17: 74,258,461 Q36* probably null Het
Nod1 C A 6: 54,943,756 A526S probably damaging Het
Nostrin G A 2: 69,183,899 V400M possibly damaging Het
Nrip1 T C 16: 76,293,032 T546A probably benign Het
Nxf1 A G 19: 8,762,763 D98G probably benign Het
Olfr1219 G T 2: 89,074,312 P260T probably benign Het
Olfr303 A T 7: 86,394,510 probably null Het
Olfr31 A G 14: 14,328,887 M259V probably benign Het
Olfr365 T A 2: 37,202,082 Y280* probably null Het
Olfr538 A G 7: 140,574,641 M163V probably benign Het
Olfr753-ps1 A T 17: 37,170,282 V20E probably damaging Het
Osgep T C 14: 50,917,921 Y60C probably damaging Het
P2ry6 A G 7: 100,938,304 Y283H probably damaging Het
Pcdha7 A T 18: 36,975,817 S632C possibly damaging Het
Pms1 T A 1: 53,194,938 R806S possibly damaging Het
Qars T A 9: 108,509,426 probably null Het
Rxfp1 T C 3: 79,686,889 N66S probably damaging Het
Slc12a5 A T 2: 164,973,765 N67I probably damaging Het
Slc1a4 G T 11: 20,304,348 T506K probably damaging Het
Tlr9 T A 9: 106,224,974 I488N probably damaging Het
Tmem110 C A 14: 30,872,533 probably benign Het
Tmem74 G T 15: 43,867,158 T163K probably damaging Het
Uba2 T C 7: 34,154,596 D307G probably damaging Het
Uty C T Y: 1,131,134 R924Q probably damaging Het
Wdr7 C T 18: 63,777,580 T681I probably benign Het
Xab2 A G 8: 3,618,105 S158P probably benign Het
Ythdc1 T C 5: 86,822,808 S418P probably damaging Het
Zfand4 T A 6: 116,328,234 C207* probably null Het
Zfp367 C T 13: 64,135,424 D305N probably damaging Het
Zfp804b C T 5: 6,772,584 V160I probably benign Het
Other mutations in Itih4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Itih4 APN 14 30895469 missense probably damaging 0.97
IGL00776:Itih4 APN 14 30889604 missense probably benign 0.03
IGL01309:Itih4 APN 14 30891749 missense probably damaging 1.00
IGL01433:Itih4 APN 14 30895448 missense probably benign 0.01
IGL01598:Itih4 APN 14 30887817 missense possibly damaging 0.92
IGL02332:Itih4 APN 14 30887860 missense probably damaging 1.00
IGL03075:Itih4 APN 14 30892283 missense probably benign 0.02
IGL03304:Itih4 APN 14 30898049 missense probably damaging 0.98
IGL03353:Itih4 APN 14 30887844 missense probably damaging 1.00
IGL03396:Itih4 APN 14 30887949 missense probably damaging 1.00
PIT4453001:Itih4 UTSW 14 30901170 missense probably benign 0.29
R0304:Itih4 UTSW 14 30890094 splice site probably null
R0477:Itih4 UTSW 14 30889674 missense probably damaging 1.00
R0783:Itih4 UTSW 14 30895423 missense possibly damaging 0.84
R0882:Itih4 UTSW 14 30892274 missense probably damaging 1.00
R1118:Itih4 UTSW 14 30896167 splice site probably benign
R1126:Itih4 UTSW 14 30889961 critical splice donor site probably null
R1238:Itih4 UTSW 14 30887949 missense probably damaging 1.00
R1456:Itih4 UTSW 14 30892653 missense probably benign 0.31
R1573:Itih4 UTSW 14 30897547 missense probably benign 0.00
R1695:Itih4 UTSW 14 30891499 critical splice donor site probably null
R2085:Itih4 UTSW 14 30892323 missense possibly damaging 0.91
R2093:Itih4 UTSW 14 30891737 missense probably damaging 1.00
R2213:Itih4 UTSW 14 30890713 missense probably damaging 0.99
R2249:Itih4 UTSW 14 30899394 nonsense probably null
R2267:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2268:Itih4 UTSW 14 30892428 missense probably damaging 1.00
R2508:Itih4 UTSW 14 30895478 missense probably damaging 1.00
R3724:Itih4 UTSW 14 30892584 missense possibly damaging 0.60
R3859:Itih4 UTSW 14 30892329 missense probably damaging 1.00
R4042:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4044:Itih4 UTSW 14 30895038 missense probably damaging 1.00
R4246:Itih4 UTSW 14 30891402 missense probably damaging 1.00
R4422:Itih4 UTSW 14 30889864 missense probably damaging 1.00
R4553:Itih4 UTSW 14 30900953 missense probably damaging 1.00
R4581:Itih4 UTSW 14 30900968 missense probably benign 0.01
R4609:Itih4 UTSW 14 30901669 missense probably damaging 1.00
R4726:Itih4 UTSW 14 30889835 missense probably damaging 1.00
R4790:Itih4 UTSW 14 30889910 missense probably damaging 1.00
R4975:Itih4 UTSW 14 30892287 missense probably damaging 1.00
R5004:Itih4 UTSW 14 30892672 missense probably damaging 1.00
R5911:Itih4 UTSW 14 30890655 missense possibly damaging 0.90
R6014:Itih4 UTSW 14 30892629 missense probably benign 0.01
R6957:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7012:Itih4 UTSW 14 30890749 missense probably benign 0.16
R7075:Itih4 UTSW 14 30892603 missense probably damaging 1.00
R7195:Itih4 UTSW 14 30899475 missense probably damaging 1.00
R7231:Itih4 UTSW 14 30896614 missense probably benign 0.17
R7509:Itih4 UTSW 14 30895447 missense probably benign 0.08
R7819:Itih4 UTSW 14 30901663 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATAATCCTTGGGCAACTGGG -3'
(R):5'- TGACATCAACTGCCTGGGTTC -3'

Sequencing Primer
(F):5'- CCTGGCCTGTATCAGAGGGAATTC -3'
(R):5'- AACTGCCTGGGTTCACACTG -3'
Posted On2015-10-08