Mutagenetix > Incidental Mutations

Incidental Mutation 'R4608:Wdr7'

350921

Institutional Source

Beutler Lab

Gene Symbol

Wdr7

Ensembl Gene

ENSMUSG00000040560

Gene Name

WD repeat domain 7

Synonyms

TGF-beta resistance associated gene, TRAG

MMRRC Submission

041819-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R4608 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

63708695-63989760 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 63777580 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 681 (T681I)

Ref Sequence

ENSEMBL: ENSMUSP00000072509 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072726]

Predicted Effect

probably benign
Transcript: ENSMUST00000072726
AA Change: T681I

PolyPhen 2 Score 0.279 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000072509
Gene: ENSMUSG00000040560
AA Change: T681I

Domain	Start	End	E-Value	Type
WD40	5	47	1.2e-2	SMART
WD40	53	95	3.71e-1	SMART
Blast:WD40	145	190	1e-18	BLAST
WD40	208	242	1.77e2	SMART
WD40	453	498	3.81e-5	SMART
WD40	501	546	4.26e1	SMART
WD40	549	588	1.63e-4	SMART
low complexity region	760	777	N/A	INTRINSIC
low complexity region	915	927	N/A	INTRINSIC
low complexity region	956	970	N/A	INTRINSIC
low complexity region	1020	1040	N/A	INTRINSIC
low complexity region	1181	1192	N/A	INTRINSIC
Blast:WD40	1341	1380	5e-20	BLAST
WD40	1382	1422	2.73e-6	SMART

Meta Mutation Damage Score

0.0940

Coding Region Coverage

1x: 99.4%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD) that may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. The encoded protein forms the beta subunit of rabconnectin-3 and binds directly with Rab3A GDP/GTP exchange protein and indirectly with Rab3A GDP/GTP activating protein; these proteins are regulators of Rab3 small G protein family members involved in control of the calcium-dependant exocytosis of neurotransmitters. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9930022D16Rik	A	G	11: 109,418,029	I74V	unknown	Het
Acss3	T	A	10: 106,967,029	I452F	possibly damaging	Het
Adam10	T	C	9: 70,743,891	L66P	probably damaging	Het
Adamts18	A	T	8: 113,737,613	C738S	probably damaging	Het
Adamts7	T	G	9: 90,174,540	S221A	probably damaging	Het
Adrm1	A	G	2: 180,174,855		probably benign	Het
Aqp1	T	C	6: 55,336,639	V50A	possibly damaging	Het
Aqp4	T	C	18: 15,398,126	I193V	probably benign	Het
B130006D01Rik	A	T	11: 95,726,240		probably benign	Het
Bbs10	T	G	10: 111,300,820	I598S	probably damaging	Het
Bbs10	A	G	10: 111,301,134	K703E	probably benign	Het
Ccnl1	C	T	3: 65,946,710		probably benign	Het
Crocc2	G	A	1: 93,168,794	V24M	possibly damaging	Het
Dab1	C	T	4: 104,731,751	A524V	probably benign	Het
Dcdc2a	T	A	13: 25,061,240	L100*	probably null	Het
Eif4g3	G	T	4: 138,126,458	R618L	probably benign	Het
F5	C	T	1: 164,209,029	P1920S	probably benign	Het
Fam187b	T	A	7: 30,977,745	N226K	probably benign	Het
Fancc	C	A	13: 63,331,823		probably benign	Het
Fastk	G	T	5: 24,443,119	P233H	probably damaging	Het
Fbn1	A	C	2: 125,306,500	D2609E	probably benign	Het
Fes	G	A	7: 80,387,211	R42W	probably damaging	Het
Fmnl2	T	A	2: 53,103,716	N374K	possibly damaging	Het
Fpgt	G	A	3: 155,086,696	Q565*	probably null	Het
Gckr	A	G	5: 31,307,797	D370G	probably damaging	Het
Ggt6	T	C	11: 72,437,943	M385T	probably benign	Het
Gm26657	C	A	4: 56,741,114	H100N	probably benign	Het
Gm6588	A	G	5: 112,449,898	S104G	possibly damaging	Het
Gsg1l	T	A	7: 125,958,549	I136F	probably damaging	Het
Hhip	C	T	8: 79,997,563	R350Q	probably damaging	Het
Ints1	C	T	5: 139,759,844	S1353N	probably benign	Het
Ints10	G	A	8: 68,810,619	R394Q	probably damaging	Het
Ints6	T	G	14: 62,703,229	R557S	probably damaging	Het
Ints9	T	A	14: 65,032,280	I473N	possibly damaging	Het
Itih4	G	A	14: 30,901,669	G915R	probably damaging	Het
Kif1a	C	A	1: 93,024,646	A1304S	possibly damaging	Het
Kif21b	C	T	1: 136,148,186		probably benign	Het
Klk13	C	A	7: 43,713,860	C10*	probably null	Het
Krtap4-8	C	T	11: 99,780,495		probably benign	Het
Lef1	T	C	3: 131,184,733	S167P	probably benign	Het
Leng8	T	A	7: 4,144,797	I607N	probably damaging	Het
Lrch4	T	A	5: 137,639,146	L526*	probably null	Het
Memo1	G	A	17: 74,258,461	Q36*	probably null	Het
Nod1	C	A	6: 54,943,756	A526S	probably damaging	Het
Nostrin	G	A	2: 69,183,899	V400M	possibly damaging	Het
Nrip1	T	C	16: 76,293,032	T546A	probably benign	Het
Nxf1	A	G	19: 8,762,763	D98G	probably benign	Het
Olfr1219	G	T	2: 89,074,312	P260T	probably benign	Het
Olfr303	A	T	7: 86,394,510		probably null	Het
Olfr31	A	G	14: 14,328,887	M259V	probably benign	Het
Olfr365	T	A	2: 37,202,082	Y280*	probably null	Het
Olfr538	A	G	7: 140,574,641	M163V	probably benign	Het
Olfr753-ps1	A	T	17: 37,170,282	V20E	probably damaging	Het
Osgep	T	C	14: 50,917,921	Y60C	probably damaging	Het
P2ry6	A	G	7: 100,938,304	Y283H	probably damaging	Het
Pcdha7	A	T	18: 36,975,817	S632C	possibly damaging	Het
Pms1	T	A	1: 53,194,938	R806S	possibly damaging	Het
Qars	T	A	9: 108,509,426		probably null	Het
Rxfp1	T	C	3: 79,686,889	N66S	probably damaging	Het
Slc12a5	A	T	2: 164,973,765	N67I	probably damaging	Het
Slc1a4	G	T	11: 20,304,348	T506K	probably damaging	Het
Tlr9	T	A	9: 106,224,974	I488N	probably damaging	Het
Tmem110	C	A	14: 30,872,533		probably benign	Het
Tmem74	G	T	15: 43,867,158	T163K	probably damaging	Het
Uba2	T	C	7: 34,154,596	D307G	probably damaging	Het
Uty	C	T	Y: 1,131,134	R924Q	probably damaging	Het
Xab2	A	G	8: 3,618,105	S158P	probably benign	Het
Ythdc1	T	C	5: 86,822,808	S418P	probably damaging	Het
Zfand4	T	A	6: 116,328,234	C207*	probably null	Het
Zfp367	C	T	13: 64,135,424	D305N	probably damaging	Het
Zfp804b	C	T	5: 6,772,584	V160I	probably benign	Het

Other mutations in Wdr7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00513:Wdr7	APN	18	63720775	missense	possibly damaging	0.83
IGL00708:Wdr7	APN	18	63778033	missense	probably benign	0.42
IGL00813:Wdr7	APN	18	63735604	missense	possibly damaging	0.84
IGL00840:Wdr7	APN	18	63927327	missense	possibly damaging	0.80
IGL00904:Wdr7	APN	18	63796231	missense	probably benign	0.43
IGL00930:Wdr7	APN	18	63740244	nonsense	probably null
IGL01481:Wdr7	APN	18	63739179	missense	probably damaging	1.00
IGL02121:Wdr7	APN	18	63777545	nonsense	probably null
IGL02346:Wdr7	APN	18	63865336	missense	probably benign	0.09
IGL02454:Wdr7	APN	18	63796228	missense	probably benign	0.20
IGL02538:Wdr7	APN	18	63796235	missense	probably benign	0.01
IGL02870:Wdr7	APN	18	63791843	missense	probably benign
IGL03054:Wdr7	APN	18	63825121	splice site	probably benign
IGL03189:Wdr7	APN	18	63760601	missense	probably benign	0.17
R0014:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0022:Wdr7	UTSW	18	63777634	missense	probably damaging	1.00
R0233:Wdr7	UTSW	18	63904101	missense	probably benign	0.03
R0432:Wdr7	UTSW	18	63796249	missense	probably damaging	0.96
R0496:Wdr7	UTSW	18	63791843	missense	probably benign
R0633:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R0931:Wdr7	UTSW	18	63865300	missense	probably benign	0.00
R1585:Wdr7	UTSW	18	63924918	missense	probably benign	0.03
R1651:Wdr7	UTSW	18	63720776	nonsense	probably null
R1804:Wdr7	UTSW	18	63865440	missense	probably damaging	1.00
R1874:Wdr7	UTSW	18	63728504	missense	probably benign	0.02
R1985:Wdr7	UTSW	18	63760583	frame shift	probably null
R2106:Wdr7	UTSW	18	63778038	missense	probably damaging	1.00
R2206:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2207:Wdr7	UTSW	18	63777607	missense	possibly damaging	0.95
R2245:Wdr7	UTSW	18	63924909	missense	possibly damaging	0.60
R2407:Wdr7	UTSW	18	63760723	missense	probably benign
R3804:Wdr7	UTSW	18	63720836	missense	probably benign
R3880:Wdr7	UTSW	18	63724155	missense	possibly damaging	0.92
R4410:Wdr7	UTSW	18	63778249	missense	probably damaging	1.00
R4441:Wdr7	UTSW	18	63755210	missense	probably damaging	1.00
R4485:Wdr7	UTSW	18	63777550	missense	possibly damaging	0.89
R4606:Wdr7	UTSW	18	63779945	nonsense	probably null
R4607:Wdr7	UTSW	18	63777580	missense	probably benign	0.28
R4711:Wdr7	UTSW	18	63728465	missense	probably benign
R4852:Wdr7	UTSW	18	63777949	missense	probably damaging	0.98
R5197:Wdr7	UTSW	18	63738866	missense	probably benign	0.02
R5213:Wdr7	UTSW	18	63755126	missense	probably damaging	1.00
R5280:Wdr7	UTSW	18	63987312	missense	probably benign	0.35
R5378:Wdr7	UTSW	18	63825239	critical splice donor site	probably null
R6076:Wdr7	UTSW	18	63739277	missense	probably damaging	1.00
R6083:Wdr7	UTSW	18	63728469	missense	probably damaging	1.00
R6168:Wdr7	UTSW	18	63777977	missense	probably damaging	0.98
R6234:Wdr7	UTSW	18	63724132	missense	probably damaging	1.00
R6295:Wdr7	UTSW	18	63755111	missense	probably damaging	1.00
R6548:Wdr7	UTSW	18	63778251	missense	possibly damaging	0.87
R6566:Wdr7	UTSW	18	63755055	missense	possibly damaging	0.72
R6696:Wdr7	UTSW	18	63739330	missense	probably benign	0.07
R6937:Wdr7	UTSW	18	63791867	missense	probably benign
R6962:Wdr7	UTSW	18	63865288	missense	possibly damaging	0.74
R7162:Wdr7	UTSW	18	63724139	missense	possibly damaging	0.92
R7376:Wdr7	UTSW	18	63777620	missense	probably damaging	1.00
R7423:Wdr7	UTSW	18	63777380	intron	probably null
R7781:Wdr7	UTSW	18	63777789	nonsense	probably null
R7851:Wdr7	UTSW	18	63720327	missense	probably benign	0.05
R7934:Wdr7	UTSW	18	63720327	missense	probably benign	0.05

Predicted Primers

PCR Primer
(F):5'- ATGGAGACTCCCACTTCAGTAAC -3'
(R):5'- TCCCAGTTAGGAAAGAGCCC -3'

Sequencing Primer
(F):5'- GATATGTTAATGACCCAGAAGCC -3'
(R):5'- TTAGGAAAGAGCCCCCTTTG -3'

Posted On

2015-10-08