Incidental Mutation 'R4613:Tbc1d8'
ID 350924
Institutional Source Beutler Lab
Gene Symbol Tbc1d8
Ensembl Gene ENSMUSG00000003134
Gene Name TBC1 domain family, member 8
Synonyms GRAM domain, BUB2-like protein 1, HBLP1, AD3
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 39410573-39517836 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 39411789 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1016 (I1016F)
Ref Sequence ENSEMBL: ENSMUSP00000049967 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054462] [ENSMUST00000086535] [ENSMUST00000178079] [ENSMUST00000179954] [ENSMUST00000193823] [ENSMUST00000194746] [ENSMUST00000195123] [ENSMUST00000192531]
AlphaFold Q9Z1A9
Predicted Effect probably damaging
Transcript: ENSMUST00000054462
AA Change: I1016F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049967
Gene: ENSMUSG00000003134
AA Change: I1016F

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 3.6e-20 SMART
GRAM 285 353 2.77e-21 SMART
TBC 501 714 4.51e-54 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 991 N/A INTRINSIC
low complexity region 1030 1045 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000086535
SMART Domains Protein: ENSMUSP00000083722
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178079
SMART Domains Protein: ENSMUSP00000136354
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179954
SMART Domains Protein: ENSMUSP00000137631
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-43 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191855
Predicted Effect probably benign
Transcript: ENSMUST00000192099
Predicted Effect probably benign
Transcript: ENSMUST00000193823
SMART Domains Protein: ENSMUSP00000141750
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
GRAM 145 212 1.2e-22 SMART
GRAM 285 353 9.6e-24 SMART
TBC 501 714 2.2e-56 SMART
Blast:TBC 726 923 1e-120 BLAST
coiled coil region 960 990 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194746
SMART Domains Protein: ENSMUSP00000141808
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 101 3.1e-40 PFAM
low complexity region 102 113 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195123
SMART Domains Protein: ENSMUSP00000142039
Gene: ENSMUSG00000073702

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:Ribosomal_L31e 18 83 7.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192531
SMART Domains Protein: ENSMUSP00000142143
Gene: ENSMUSG00000003134

DomainStartEndE-ValueType
low complexity region 28 49 N/A INTRINSIC
low complexity region 80 98 N/A INTRINSIC
low complexity region 144 152 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map2 A G 1: 66,464,628 (GRCm39) N287D probably damaging Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Tbc1d8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Tbc1d8 APN 1 39,433,210 (GRCm39) missense probably damaging 0.96
IGL01501:Tbc1d8 APN 1 39,428,416 (GRCm39) missense probably damaging 1.00
IGL01548:Tbc1d8 APN 1 39,420,385 (GRCm39) missense probably damaging 0.96
IGL01884:Tbc1d8 APN 1 39,415,526 (GRCm39) missense probably damaging 1.00
IGL01919:Tbc1d8 APN 1 39,431,334 (GRCm39) missense probably damaging 1.00
IGL02123:Tbc1d8 APN 1 39,419,317 (GRCm39) missense probably damaging 0.98
IGL02123:Tbc1d8 APN 1 39,415,988 (GRCm39) missense possibly damaging 0.54
IGL02135:Tbc1d8 APN 1 39,441,891 (GRCm39) missense probably damaging 1.00
IGL02317:Tbc1d8 APN 1 39,415,985 (GRCm39) missense probably benign 0.00
IGL02325:Tbc1d8 APN 1 39,433,321 (GRCm39) missense probably damaging 0.99
IGL02607:Tbc1d8 APN 1 39,418,592 (GRCm39) missense probably benign 0.05
R0533:Tbc1d8 UTSW 1 39,411,855 (GRCm39) missense possibly damaging 0.82
R0604:Tbc1d8 UTSW 1 39,444,407 (GRCm39) missense probably damaging 1.00
R0612:Tbc1d8 UTSW 1 39,411,596 (GRCm39) missense possibly damaging 0.92
R0639:Tbc1d8 UTSW 1 39,430,290 (GRCm39) missense probably benign 0.00
R0976:Tbc1d8 UTSW 1 39,445,882 (GRCm39) missense probably damaging 1.00
R1051:Tbc1d8 UTSW 1 39,420,534 (GRCm39) nonsense probably null
R1605:Tbc1d8 UTSW 1 39,430,206 (GRCm39) missense probably benign 0.38
R1622:Tbc1d8 UTSW 1 39,419,317 (GRCm39) missense probably benign 0.00
R1710:Tbc1d8 UTSW 1 39,445,918 (GRCm39) missense possibly damaging 0.89
R2419:Tbc1d8 UTSW 1 39,415,983 (GRCm39) missense probably damaging 1.00
R2437:Tbc1d8 UTSW 1 39,444,368 (GRCm39) splice site probably null
R2862:Tbc1d8 UTSW 1 39,441,777 (GRCm39) nonsense probably null
R2870:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R2870:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R2872:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R2873:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R2874:Tbc1d8 UTSW 1 39,444,398 (GRCm39) missense probably damaging 1.00
R3759:Tbc1d8 UTSW 1 39,415,546 (GRCm39) missense probably damaging 1.00
R4127:Tbc1d8 UTSW 1 39,411,512 (GRCm39) missense probably benign 0.05
R4154:Tbc1d8 UTSW 1 39,425,216 (GRCm39) missense probably damaging 0.99
R4737:Tbc1d8 UTSW 1 39,441,959 (GRCm39) missense possibly damaging 0.63
R4738:Tbc1d8 UTSW 1 39,441,959 (GRCm39) missense possibly damaging 0.63
R4739:Tbc1d8 UTSW 1 39,441,959 (GRCm39) missense possibly damaging 0.63
R4740:Tbc1d8 UTSW 1 39,441,959 (GRCm39) missense possibly damaging 0.63
R5189:Tbc1d8 UTSW 1 39,424,213 (GRCm39) missense probably benign 0.00
R5271:Tbc1d8 UTSW 1 39,412,848 (GRCm39) missense probably damaging 0.97
R5308:Tbc1d8 UTSW 1 39,428,490 (GRCm39) missense probably damaging 1.00
R5393:Tbc1d8 UTSW 1 39,465,169 (GRCm39) missense probably damaging 0.99
R5529:Tbc1d8 UTSW 1 39,411,836 (GRCm39) missense probably benign 0.42
R5897:Tbc1d8 UTSW 1 39,431,190 (GRCm39) missense possibly damaging 0.95
R6160:Tbc1d8 UTSW 1 39,411,484 (GRCm39) missense probably damaging 0.98
R6408:Tbc1d8 UTSW 1 39,441,980 (GRCm39) missense probably damaging 0.99
R6409:Tbc1d8 UTSW 1 39,411,669 (GRCm39) missense probably benign 0.00
R6554:Tbc1d8 UTSW 1 39,445,903 (GRCm39) missense probably damaging 1.00
R6841:Tbc1d8 UTSW 1 39,428,455 (GRCm39) missense possibly damaging 0.68
R7282:Tbc1d8 UTSW 1 39,411,614 (GRCm39) missense probably benign 0.00
R7294:Tbc1d8 UTSW 1 39,445,843 (GRCm39) missense probably damaging 1.00
R7384:Tbc1d8 UTSW 1 39,433,179 (GRCm39) missense probably benign 0.00
R7718:Tbc1d8 UTSW 1 39,416,061 (GRCm39) missense probably benign 0.00
R7881:Tbc1d8 UTSW 1 39,425,104 (GRCm39) missense probably damaging 0.98
R7918:Tbc1d8 UTSW 1 39,441,809 (GRCm39) missense probably damaging 1.00
R7972:Tbc1d8 UTSW 1 39,431,250 (GRCm39) missense probably damaging 1.00
R8269:Tbc1d8 UTSW 1 39,465,169 (GRCm39) missense probably benign 0.00
R8352:Tbc1d8 UTSW 1 39,444,438 (GRCm39) missense probably damaging 1.00
R8425:Tbc1d8 UTSW 1 39,420,490 (GRCm39) missense probably damaging 1.00
R8452:Tbc1d8 UTSW 1 39,444,438 (GRCm39) missense probably damaging 1.00
R9159:Tbc1d8 UTSW 1 39,444,474 (GRCm39) missense
R9712:Tbc1d8 UTSW 1 39,424,313 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGAAGGGATGCCAAAATATGTTC -3'
(R):5'- AGAACTGTTTCCCATGGCAC -3'

Sequencing Primer
(F):5'- TGCCAAAATATGTTCAAGGGACAC -3'
(R):5'- TGGCACAAAGATTAAGCAGCATAC -3'
Posted On 2015-10-08