Incidental Mutation 'R4613:Orc2'
ID350926
Institutional Source Beutler Lab
Gene Symbol Orc2
Ensembl Gene ENSMUSG00000026037
Gene Nameorigin recognition complex, subunit 2
SynonymsOrc2l
MMRRC Submission 041824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R4613 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location58462771-58505109 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 58500309 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 57 (L57*)
Ref Sequence ENSEMBL: ENSMUSP00000027198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000190695] [ENSMUST00000191206]
Predicted Effect probably null
Transcript: ENSMUST00000027198
AA Change: L57*
SMART Domains Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: L57*

DomainStartEndE-ValueType
low complexity region 176 201 N/A INTRINSIC
Pfam:ORC2 254 563 2.5e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114325
SMART Domains Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037

DomainStartEndE-ValueType
low complexity region 128 153 N/A INTRINSIC
Pfam:ORC2 206 517 1.2e-108 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129740
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160947
Predicted Effect probably benign
Transcript: ENSMUST00000190695
Predicted Effect probably benign
Transcript: ENSMUST00000191206
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Areg A G 5: 91,143,504 K102R probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gli2 A G 1: 118,837,511 V970A probably damaging Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map1b A T 13: 99,430,302 Y1970* probably null Het
Map2 A G 1: 66,425,469 N287D probably damaging Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xirp1 A G 9: 120,019,682 F45S probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Orc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Orc2 APN 1 58493716 missense possibly damaging 0.81
IGL00549:Orc2 APN 1 58481042 missense probably benign 0.00
IGL01343:Orc2 APN 1 58492855 critical splice donor site probably null
IGL01357:Orc2 APN 1 58497392 missense probably benign 0.26
IGL01357:Orc2 APN 1 58497393 missense probably benign 0.00
IGL02167:Orc2 APN 1 58483639 unclassified probably benign
IGL02343:Orc2 APN 1 58469666 critical splice donor site probably null
IGL02548:Orc2 APN 1 58466122 unclassified probably benign
R0557:Orc2 UTSW 1 58469687 missense probably damaging 1.00
R1470:Orc2 UTSW 1 58481158 unclassified probably benign
R1886:Orc2 UTSW 1 58471088 critical splice acceptor site probably null
R2065:Orc2 UTSW 1 58469695 missense probably damaging 1.00
R3848:Orc2 UTSW 1 58480992 missense probably benign 0.08
R4389:Orc2 UTSW 1 58474861 missense probably benign 0.21
R4393:Orc2 UTSW 1 58467650 critical splice donor site probably null
R5183:Orc2 UTSW 1 58474818 missense possibly damaging 0.83
R5652:Orc2 UTSW 1 58466072 missense probably damaging 0.99
R5793:Orc2 UTSW 1 58497388 start codon destroyed probably null 0.27
R5997:Orc2 UTSW 1 58472388 missense probably damaging 1.00
R6007:Orc2 UTSW 1 58467692 missense probably benign 0.03
R6330:Orc2 UTSW 1 58500334 missense probably benign
R6656:Orc2 UTSW 1 58493659 critical splice donor site probably null
R6923:Orc2 UTSW 1 58500375 missense probably benign 0.01
R6934:Orc2 UTSW 1 58500364 missense probably benign 0.28
R7354:Orc2 UTSW 1 58469747 missense possibly damaging 0.96
R7718:Orc2 UTSW 1 58480317 missense possibly damaging 0.65
R7950:Orc2 UTSW 1 58467668 missense possibly damaging 0.64
Z1088:Orc2 UTSW 1 58476516 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTTTAGATTCGACACACAACTGTAC -3'
(R):5'- ACTGACCCTGCGTTTAGTGTG -3'

Sequencing Primer
(F):5'- TTCGACACACAACTGTACTATATGAC -3'
(R):5'- AGGACAACTCTCTGGAATTGGTTCTC -3'
Posted On2015-10-08