Incidental Mutation 'R4613:Map2'
ID 350927
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Name microtubule-associated protein 2
Synonyms G1-397-34, MAP-2, Mtap2, repro4
MMRRC Submission 041824-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.751) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 66214432-66481742 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66464628 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 287 (N287D)
Ref Sequence ENSEMBL: ENSMUSP00000134651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000173800] [ENSMUST00000172886] [ENSMUST00000173778]
AlphaFold P20357
Predicted Effect probably damaging
Transcript: ENSMUST00000024639
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077355
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114012
AA Change: N311D

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222
AA Change: N311D

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: N1673D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: N1673D

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114015
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: N312D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: N312D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably benign
Transcript: ENSMUST00000173800
AA Change: N185D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222
AA Change: N185D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000172886
AA Change: N242D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: N242D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173778
AA Change: N287D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: N287D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,439,167 (GRCm39) L130I probably benign Het
Abca9 A G 11: 110,035,610 (GRCm39) V670A probably benign Het
Adad1 A G 3: 37,146,182 (GRCm39) N517D probably damaging Het
Ankle2 T C 5: 110,379,245 (GRCm39) L48P probably benign Het
Aoc3 A T 11: 101,228,485 (GRCm39) probably benign Het
Areg A G 5: 91,291,363 (GRCm39) K102R probably benign Het
Bmp1 T C 14: 70,745,963 (GRCm39) T167A probably damaging Het
C4b C T 17: 34,953,525 (GRCm39) G986D probably benign Het
Caml G T 13: 55,772,955 (GRCm39) G200C probably damaging Het
Ccdc40 A C 11: 119,122,358 (GRCm39) R53S probably benign Het
Cdh22 T A 2: 164,985,576 (GRCm39) I337L probably benign Het
Col12a1 A T 9: 79,554,883 (GRCm39) V2065D probably benign Het
Copg2 A G 6: 30,788,531 (GRCm39) S591P probably benign Het
Cyp2d34 G A 15: 82,500,526 (GRCm39) P438S probably damaging Het
Dchs1 T C 7: 105,421,931 (GRCm39) D163G probably damaging Het
Depdc1b T C 13: 108,500,177 (GRCm39) V230A probably damaging Het
Depdc5 T A 5: 33,132,790 (GRCm39) L1300H probably damaging Het
Dnah10 G T 5: 124,839,933 (GRCm39) probably null Het
Dsc2 A T 18: 20,174,876 (GRCm39) D466E probably damaging Het
Dthd1 A G 5: 62,984,411 (GRCm39) D372G probably damaging Het
Eeig2 A T 3: 108,934,571 (GRCm39) F23I probably benign Het
Eogt G T 6: 97,111,265 (GRCm39) Q199K probably benign Het
Epha6 C A 16: 59,486,960 (GRCm39) R1029L possibly damaging Het
Eppin C A 2: 164,431,243 (GRCm39) E128* probably null Het
Fgf20 T C 8: 40,739,652 (GRCm39) R33G probably benign Het
Fgg A G 3: 82,917,397 (GRCm39) N142S probably damaging Het
Fhip2a C A 19: 57,359,619 (GRCm39) P53Q probably damaging Het
Gba1 C T 3: 89,115,951 (GRCm39) probably null Het
Gli2 A G 1: 118,765,241 (GRCm39) V970A probably damaging Het
Gramd1b A T 9: 40,219,289 (GRCm39) V508D probably damaging Het
Gucy2c T A 6: 136,685,319 (GRCm39) D898V probably damaging Het
Kcnj15 T C 16: 95,096,653 (GRCm39) Y92H probably damaging Het
L3mbtl3 A T 10: 26,158,693 (GRCm39) S652T unknown Het
Ldb2 G T 5: 44,633,893 (GRCm39) Q326K probably benign Het
Lipi C A 16: 75,357,689 (GRCm39) R292L probably benign Het
Lrrc36 G A 8: 106,176,246 (GRCm39) V207I possibly damaging Het
Lyplal1 C T 1: 185,820,949 (GRCm39) G166D probably benign Het
Map1b A T 13: 99,566,810 (GRCm39) Y1970* probably null Het
Map3k11 A T 19: 5,747,498 (GRCm39) Q578L probably benign Het
Map3k11 G T 19: 5,747,499 (GRCm39) Q578H probably damaging Het
Map4k4 G A 1: 40,056,351 (GRCm39) S1012N probably benign Het
Mapk13 A T 17: 28,988,426 (GRCm39) N15Y probably damaging Het
Mapk15 G A 15: 75,867,759 (GRCm39) A125T probably damaging Het
Mrgprb1 C A 7: 48,097,456 (GRCm39) R152L possibly damaging Het
Mtrex C A 13: 113,058,273 (GRCm39) E53* probably null Het
Muc5ac T G 7: 141,344,840 (GRCm39) Y104D possibly damaging Het
Myo1h A G 5: 114,486,440 (GRCm39) N566S possibly damaging Het
Myo1h C A 5: 114,489,737 (GRCm39) H647Q probably benign Het
Neo1 A G 9: 58,796,324 (GRCm39) I1201T possibly damaging Het
Nlgn1 T C 3: 25,490,186 (GRCm39) T514A probably benign Het
Or10al4 A G 17: 38,037,587 (GRCm39) Y224C probably damaging Het
Or12j4 A T 7: 140,046,981 (GRCm39) Y289F probably damaging Het
Or7a42 A G 10: 78,791,899 (GRCm39) N287D probably damaging Het
Or8d4 T A 9: 40,039,018 (GRCm39) K80* probably null Het
Orc2 A T 1: 58,539,468 (GRCm39) L57* probably null Het
Otoa G A 7: 120,744,791 (GRCm39) V850M probably damaging Het
Pcnx3 T C 19: 5,717,247 (GRCm39) T1579A possibly damaging Het
Pde5a A T 3: 122,616,742 (GRCm39) Y564F probably damaging Het
Pdxk A C 10: 78,283,753 (GRCm39) I147S probably damaging Het
Pfdn5 A G 15: 102,237,187 (GRCm39) D108G probably benign Het
Pink1 T C 4: 138,044,621 (GRCm39) D342G probably damaging Het
Prkacb A T 3: 146,443,753 (GRCm39) V336E probably damaging Het
Ptpro C A 6: 137,393,834 (GRCm39) S13* probably null Het
Rfng A G 11: 120,673,476 (GRCm39) L215P probably damaging Het
Rpn2 T C 2: 157,144,345 (GRCm39) F336L possibly damaging Het
Sacs A G 14: 61,449,246 (GRCm39) probably null Het
Sirpb1a T A 3: 15,482,097 (GRCm39) Y77F probably benign Het
Slc30a8 A G 15: 52,196,971 (GRCm39) D294G probably benign Het
Sox13 T C 1: 133,316,672 (GRCm39) I212V probably benign Het
Srebf2 T A 15: 82,069,549 (GRCm39) I657N possibly damaging Het
Srsf6 C A 2: 162,775,629 (GRCm39) T146K probably benign Het
Strn4 T C 7: 16,558,088 (GRCm39) V162A possibly damaging Het
Sulf2 T C 2: 165,974,525 (GRCm39) D53G probably damaging Het
Tbc1d8 T A 1: 39,411,789 (GRCm39) I1016F probably damaging Het
Tfrc G T 16: 32,437,475 (GRCm39) A278S probably damaging Het
Tnrc6a T G 7: 122,783,512 (GRCm39) probably null Het
Vmn1r83 T C 7: 12,055,695 (GRCm39) I121V probably benign Het
Vps13d T C 4: 144,858,225 (GRCm39) S2200G possibly damaging Het
Washc2 T A 6: 116,206,230 (GRCm39) D397E probably damaging Het
Wipf3 T C 6: 54,462,540 (GRCm39) L250P probably damaging Het
Xirp1 A G 9: 119,848,748 (GRCm39) F45S probably damaging Het
Xpo5 A G 17: 46,547,889 (GRCm39) T910A probably benign Het
Zfp235 T C 7: 23,841,101 (GRCm39) Y507H probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66,464,490 (GRCm39) missense probably damaging 1.00
IGL02135:Map2 APN 1 66,419,920 (GRCm39) nonsense probably null
IGL02526:Map2 APN 1 66,419,876 (GRCm39) missense possibly damaging 0.94
Annas UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
calliope UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
carthage UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
costas UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
Jacobin UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
Nectar UTSW 1 66,454,522 (GRCm39) nonsense probably null
ruby_throat UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
Rufous UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
Speckled UTSW 1 66,451,886 (GRCm39) nonsense probably null
Sunbird UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
swift UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
E0370:Map2 UTSW 1 66,455,883 (GRCm39) unclassified probably benign
PIT4362001:Map2 UTSW 1 66,451,677 (GRCm39) missense probably benign 0.05
R0067:Map2 UTSW 1 66,452,322 (GRCm39) missense probably benign 0.04
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0238:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0239:Map2 UTSW 1 66,455,265 (GRCm39) missense probably damaging 1.00
R0268:Map2 UTSW 1 66,419,881 (GRCm39) nonsense probably null
R0302:Map2 UTSW 1 66,453,987 (GRCm39) missense probably benign 0.15
R0305:Map2 UTSW 1 66,452,253 (GRCm39) missense probably benign 0.00
R0409:Map2 UTSW 1 66,472,739 (GRCm39) missense probably damaging 1.00
R0561:Map2 UTSW 1 66,464,656 (GRCm39) missense probably damaging 1.00
R0674:Map2 UTSW 1 66,452,361 (GRCm39) missense probably damaging 1.00
R0738:Map2 UTSW 1 66,464,348 (GRCm39) splice site probably benign
R0893:Map2 UTSW 1 66,419,927 (GRCm39) missense probably damaging 1.00
R1305:Map2 UTSW 1 66,464,554 (GRCm39) missense probably damaging 1.00
R1534:Map2 UTSW 1 66,452,339 (GRCm39) missense probably benign 0.33
R1632:Map2 UTSW 1 66,454,245 (GRCm39) missense possibly damaging 0.60
R1682:Map2 UTSW 1 66,454,781 (GRCm39) splice site probably null
R1774:Map2 UTSW 1 66,453,233 (GRCm39) missense probably damaging 1.00
R2014:Map2 UTSW 1 66,455,295 (GRCm39) missense possibly damaging 0.55
R2017:Map2 UTSW 1 66,451,958 (GRCm39) missense probably damaging 1.00
R2050:Map2 UTSW 1 66,453,473 (GRCm39) missense probably damaging 0.98
R2093:Map2 UTSW 1 66,438,599 (GRCm39) missense probably damaging 1.00
R2214:Map2 UTSW 1 66,459,345 (GRCm39) missense probably damaging 0.99
R2284:Map2 UTSW 1 66,453,227 (GRCm39) missense probably damaging 1.00
R3011:Map2 UTSW 1 66,453,771 (GRCm39) missense probably damaging 1.00
R3105:Map2 UTSW 1 66,472,756 (GRCm39) critical splice donor site probably null
R3708:Map2 UTSW 1 66,455,714 (GRCm39) unclassified probably benign
R3709:Map2 UTSW 1 66,455,015 (GRCm39) nonsense probably null
R3729:Map2 UTSW 1 66,451,605 (GRCm39) missense possibly damaging 0.80
R3760:Map2 UTSW 1 66,478,077 (GRCm39) missense probably damaging 1.00
R3788:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R3789:Map2 UTSW 1 66,456,022 (GRCm39) missense probably damaging 0.99
R4003:Map2 UTSW 1 66,454,899 (GRCm39) missense probably damaging 1.00
R4120:Map2 UTSW 1 66,455,063 (GRCm39) missense probably damaging 1.00
R4172:Map2 UTSW 1 66,452,759 (GRCm39) missense possibly damaging 0.89
R4198:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4200:Map2 UTSW 1 66,464,457 (GRCm39) missense probably damaging 1.00
R4205:Map2 UTSW 1 66,464,449 (GRCm39) missense probably damaging 1.00
R4700:Map2 UTSW 1 66,449,796 (GRCm39) missense probably damaging 0.96
R4974:Map2 UTSW 1 66,452,664 (GRCm39) missense probably benign 0.15
R5007:Map2 UTSW 1 66,452,448 (GRCm39) missense possibly damaging 0.86
R5039:Map2 UTSW 1 66,477,955 (GRCm39) missense probably damaging 1.00
R5237:Map2 UTSW 1 66,478,169 (GRCm39) unclassified probably benign
R5313:Map2 UTSW 1 66,464,538 (GRCm39) missense probably damaging 1.00
R5455:Map2 UTSW 1 66,438,550 (GRCm39) missense probably damaging 1.00
R5490:Map2 UTSW 1 66,452,292 (GRCm39) missense probably damaging 1.00
R5517:Map2 UTSW 1 66,454,415 (GRCm39) missense probably benign 0.00
R5532:Map2 UTSW 1 66,453,779 (GRCm39) missense probably damaging 1.00
R5583:Map2 UTSW 1 66,455,196 (GRCm39) missense probably damaging 1.00
R5764:Map2 UTSW 1 66,454,034 (GRCm39) missense probably damaging 0.99
R5996:Map2 UTSW 1 66,454,043 (GRCm39) missense possibly damaging 0.67
R6058:Map2 UTSW 1 66,454,573 (GRCm39) missense probably benign 0.05
R6199:Map2 UTSW 1 66,464,637 (GRCm39) missense probably damaging 1.00
R6208:Map2 UTSW 1 66,470,749 (GRCm39) missense probably damaging 1.00
R6276:Map2 UTSW 1 66,438,578 (GRCm39) missense probably damaging 1.00
R6378:Map2 UTSW 1 66,454,488 (GRCm39) missense probably damaging 1.00
R6424:Map2 UTSW 1 66,453,946 (GRCm39) missense possibly damaging 0.67
R6743:Map2 UTSW 1 66,454,766 (GRCm39) missense probably benign 0.04
R6837:Map2 UTSW 1 66,453,731 (GRCm39) missense probably damaging 1.00
R6901:Map2 UTSW 1 66,460,932 (GRCm39) missense possibly damaging 0.94
R6984:Map2 UTSW 1 66,454,395 (GRCm39) missense possibly damaging 0.90
R6989:Map2 UTSW 1 66,454,065 (GRCm39) missense probably benign 0.00
R7001:Map2 UTSW 1 66,454,646 (GRCm39) missense probably benign 0.01
R7055:Map2 UTSW 1 66,455,983 (GRCm39) missense probably damaging 1.00
R7094:Map2 UTSW 1 66,451,886 (GRCm39) nonsense probably null
R7106:Map2 UTSW 1 66,449,903 (GRCm39) missense possibly damaging 0.92
R7182:Map2 UTSW 1 66,451,812 (GRCm39) missense possibly damaging 0.94
R7235:Map2 UTSW 1 66,453,807 (GRCm39) missense probably damaging 1.00
R7424:Map2 UTSW 1 66,453,983 (GRCm39) missense possibly damaging 0.69
R7473:Map2 UTSW 1 66,454,617 (GRCm39) missense probably damaging 1.00
R7642:Map2 UTSW 1 66,452,466 (GRCm39) missense probably benign 0.01
R7660:Map2 UTSW 1 66,453,536 (GRCm39) missense probably damaging 1.00
R7673:Map2 UTSW 1 66,452,933 (GRCm39) missense probably benign 0.03
R7768:Map2 UTSW 1 66,453,642 (GRCm39) missense possibly damaging 0.94
R7796:Map2 UTSW 1 66,455,654 (GRCm39) splice site probably null
R7834:Map2 UTSW 1 66,455,647 (GRCm39) missense probably damaging 1.00
R7842:Map2 UTSW 1 66,455,570 (GRCm39) missense probably benign
R7955:Map2 UTSW 1 66,452,875 (GRCm39) missense probably damaging 1.00
R8056:Map2 UTSW 1 66,454,779 (GRCm39) missense probably damaging 0.99
R8118:Map2 UTSW 1 66,464,550 (GRCm39) missense probably damaging 1.00
R8135:Map2 UTSW 1 66,452,828 (GRCm39) missense probably damaging 1.00
R8152:Map2 UTSW 1 66,453,902 (GRCm39) missense probably benign 0.00
R8223:Map2 UTSW 1 66,464,649 (GRCm39) missense probably damaging 1.00
R8329:Map2 UTSW 1 66,454,272 (GRCm39) missense probably benign 0.01
R8344:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8475:Map2 UTSW 1 66,453,164 (GRCm39) missense probably damaging 1.00
R8548:Map2 UTSW 1 66,452,499 (GRCm39) missense probably damaging 1.00
R8680:Map2 UTSW 1 66,460,872 (GRCm39) missense probably damaging 1.00
R8713:Map2 UTSW 1 66,453,781 (GRCm39) missense probably damaging 1.00
R8745:Map2 UTSW 1 66,452,556 (GRCm39) missense probably benign 0.00
R8786:Map2 UTSW 1 66,472,755 (GRCm39) critical splice donor site probably benign
R8790:Map2 UTSW 1 66,477,997 (GRCm39) missense probably damaging 1.00
R8874:Map2 UTSW 1 66,455,523 (GRCm39) missense probably damaging 1.00
R8887:Map2 UTSW 1 66,454,758 (GRCm39) missense possibly damaging 0.48
R8948:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8950:Map2 UTSW 1 66,419,684 (GRCm39) missense probably damaging 1.00
R8998:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R8999:Map2 UTSW 1 66,452,473 (GRCm39) missense possibly damaging 0.91
R9072:Map2 UTSW 1 66,453,312 (GRCm39) missense probably damaging 1.00
R9088:Map2 UTSW 1 66,453,773 (GRCm39) missense probably damaging 1.00
R9089:Map2 UTSW 1 66,452,098 (GRCm39) missense probably benign 0.09
R9106:Map2 UTSW 1 66,454,522 (GRCm39) nonsense probably null
R9112:Map2 UTSW 1 66,472,723 (GRCm39) nonsense probably null
R9120:Map2 UTSW 1 66,453,218 (GRCm39) missense probably damaging 1.00
R9161:Map2 UTSW 1 66,477,503 (GRCm39) missense possibly damaging 0.65
R9464:Map2 UTSW 1 66,454,497 (GRCm39) missense probably damaging 1.00
R9589:Map2 UTSW 1 66,449,753 (GRCm39) missense probably benign
V8831:Map2 UTSW 1 66,455,004 (GRCm39) missense probably damaging 1.00
Z1177:Map2 UTSW 1 66,477,520 (GRCm39) missense probably damaging 0.96
Z1177:Map2 UTSW 1 66,419,839 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGGATCAACTGCAATCACCC -3'
(R):5'- GGTGACCCATGACCCTGTAAAC -3'

Sequencing Primer
(F):5'- AGCTACTCTTCACGTACCCCAG -3'
(R):5'- CCATGACCCTGTAAACATCTCTG -3'
Posted On 2015-10-08