Incidental Mutation 'R4613:Map2'
ID350927
Institutional Source Beutler Lab
Gene Symbol Map2
Ensembl Gene ENSMUSG00000015222
Gene Namemicrotubule-associated protein 2
Synonymsrepro4, MAP-2, Mtap2, G1-397-34
MMRRC Submission 041824-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.768) question?
Stock #R4613 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location66175273-66442583 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66425469 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 287 (N287D)
Ref Sequence ENSEMBL: ENSMUSP00000134651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024639] [ENSMUST00000077355] [ENSMUST00000114012] [ENSMUST00000114013] [ENSMUST00000114015] [ENSMUST00000114017] [ENSMUST00000114018] [ENSMUST00000172886] [ENSMUST00000173778] [ENSMUST00000173800]
Predicted Effect probably damaging
Transcript: ENSMUST00000024639
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024639
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077355
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000076577
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114012
AA Change: N311D

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109645
Gene: ENSMUSG00000015222
AA Change: N311D

DomainStartEndE-ValueType
low complexity region 133 140 N/A INTRINSIC
low complexity region 181 195 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 228 250 N/A INTRINSIC
Pfam:Tubulin-binding 299 330 2.1e-18 PFAM
Pfam:Tubulin-binding 331 361 9.1e-20 PFAM
Pfam:Tubulin-binding 362 393 1.7e-17 PFAM
low complexity region 421 434 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114013
AA Change: N1673D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109646
Gene: ENSMUSG00000015222
AA Change: N1673D

DomainStartEndE-ValueType
Pfam:RII_binding_1 86 103 1.2e-5 PFAM
low complexity region 120 141 N/A INTRINSIC
Pfam:MAP2_projctn 376 1510 N/A PFAM
low complexity region 1543 1557 N/A INTRINSIC
low complexity region 1567 1583 N/A INTRINSIC
low complexity region 1590 1612 N/A INTRINSIC
Pfam:Tubulin-binding 1662 1692 1.7e-13 PFAM
Pfam:Tubulin-binding 1693 1723 5.8e-18 PFAM
Pfam:Tubulin-binding 1724 1755 5.9e-18 PFAM
low complexity region 1783 1796 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114015
AA Change: N312D

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000109648
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.1e-18 PFAM
Pfam:Tubulin-binding 332 362 9.1e-20 PFAM
Pfam:Tubulin-binding 363 394 1.7e-17 PFAM
low complexity region 422 435 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114017
AA Change: N312D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109650
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114018
AA Change: N312D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109651
Gene: ENSMUSG00000015222
AA Change: N312D

DomainStartEndE-ValueType
low complexity region 120 141 N/A INTRINSIC
low complexity region 182 196 N/A INTRINSIC
low complexity region 206 222 N/A INTRINSIC
low complexity region 229 251 N/A INTRINSIC
Pfam:Tubulin-binding 300 331 2.3e-18 PFAM
Pfam:Tubulin-binding 332 362 2.3e-19 PFAM
Pfam:Tubulin-binding 363 393 9.9e-20 PFAM
Pfam:Tubulin-binding 394 425 1.9e-17 PFAM
low complexity region 453 466 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133522
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151423
Predicted Effect probably damaging
Transcript: ENSMUST00000172886
AA Change: N242D

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133446
Gene: ENSMUSG00000015222
AA Change: N242D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 107 3.9e-54 PFAM
low complexity region 112 126 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
low complexity region 159 181 N/A INTRINSIC
Pfam:Tubulin-binding 230 261 1.4e-18 PFAM
Pfam:Tubulin-binding 262 292 1.4e-19 PFAM
Pfam:Tubulin-binding 293 323 6e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173778
AA Change: N287D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134651
Gene: ENSMUSG00000015222
AA Change: N287D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 124 4.8e-84 PFAM
low complexity region 157 171 N/A INTRINSIC
low complexity region 181 197 N/A INTRINSIC
low complexity region 204 226 N/A INTRINSIC
Pfam:Tubulin-binding 275 306 1.6e-18 PFAM
Pfam:Tubulin-binding 307 337 1.6e-19 PFAM
Pfam:Tubulin-binding 338 368 7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173800
AA Change: N185D

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000134518
Gene: ENSMUSG00000015222
AA Change: N185D

DomainStartEndE-ValueType
Pfam:MAP2_projctn 1 23 2.2e-11 PFAM
low complexity region 55 69 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 102 124 N/A INTRINSIC
Pfam:Tubulin-binding 173 204 8.7e-19 PFAM
Pfam:Tubulin-binding 205 235 3.8e-20 PFAM
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The products of similar genes in rat and mouse are neuron-specific cytoskeletal proteins that are enriched in dentrites, implicating a role in determining and stabilizing dentritic shape during neuron development. A number of alternatively spliced variants encoding distinct isoforms have been described. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered contextual memory. Mice homozygous for another knock-out allele display decreased body weight, altered microtubule density and organization in Purkinje cell dendrites, and reduced dendritic length inhippocampal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Areg A G 5: 91,143,504 K102R probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gli2 A G 1: 118,837,511 V970A probably damaging Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map1b A T 13: 99,430,302 Y1970* probably null Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Orc2 A T 1: 58,500,309 L57* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xirp1 A G 9: 120,019,682 F45S probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Map2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01518:Map2 APN 1 66425331 missense probably damaging 1.00
IGL02135:Map2 APN 1 66380761 nonsense probably null
IGL02526:Map2 APN 1 66380717 missense possibly damaging 0.94
Annas UTSW 1 66433597 critical splice donor site probably null
calliope UTSW 1 66425298 missense probably damaging 1.00
carthage UTSW 1 66414648 missense probably damaging 1.00
costas UTSW 1 66412653 missense possibly damaging 0.94
Jacobin UTSW 1 66399419 missense probably damaging 1.00
ruby_throat UTSW 1 66414884 missense possibly damaging 0.67
Rufous UTSW 1 66380768 missense probably damaging 1.00
Speckled UTSW 1 66412727 nonsense probably null
Sunbird UTSW 1 66415487 missense probably benign 0.01
E0370:Map2 UTSW 1 66416724 unclassified probably benign
PIT4362001:Map2 UTSW 1 66412518 missense probably benign 0.05
R0067:Map2 UTSW 1 66413163 missense probably benign 0.04
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0238:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0239:Map2 UTSW 1 66416106 missense probably damaging 1.00
R0268:Map2 UTSW 1 66380722 nonsense probably null
R0302:Map2 UTSW 1 66414828 missense probably benign 0.15
R0305:Map2 UTSW 1 66413094 missense probably benign 0.00
R0409:Map2 UTSW 1 66433580 missense probably damaging 1.00
R0561:Map2 UTSW 1 66425497 missense probably damaging 1.00
R0674:Map2 UTSW 1 66413202 missense probably damaging 1.00
R0738:Map2 UTSW 1 66425189 splice site probably benign
R0893:Map2 UTSW 1 66380768 missense probably damaging 1.00
R1305:Map2 UTSW 1 66425395 missense probably damaging 1.00
R1534:Map2 UTSW 1 66413180 missense probably benign 0.33
R1632:Map2 UTSW 1 66415086 missense possibly damaging 0.60
R1682:Map2 UTSW 1 66415622 splice site probably null
R1774:Map2 UTSW 1 66414074 missense probably damaging 1.00
R2014:Map2 UTSW 1 66416136 missense possibly damaging 0.55
R2017:Map2 UTSW 1 66412799 missense probably damaging 1.00
R2050:Map2 UTSW 1 66414314 missense probably damaging 0.98
R2093:Map2 UTSW 1 66399440 missense probably damaging 1.00
R2214:Map2 UTSW 1 66420186 missense probably damaging 0.99
R2284:Map2 UTSW 1 66414068 missense probably damaging 1.00
R3011:Map2 UTSW 1 66414612 missense probably damaging 1.00
R3105:Map2 UTSW 1 66433597 critical splice donor site probably null
R3708:Map2 UTSW 1 66416555 unclassified probably benign
R3709:Map2 UTSW 1 66415856 nonsense probably null
R3729:Map2 UTSW 1 66412446 missense possibly damaging 0.80
R3760:Map2 UTSW 1 66438918 missense probably damaging 1.00
R3788:Map2 UTSW 1 66416863 missense probably damaging 0.99
R3789:Map2 UTSW 1 66416863 missense probably damaging 0.99
R4003:Map2 UTSW 1 66415740 missense probably damaging 1.00
R4120:Map2 UTSW 1 66415904 missense probably damaging 1.00
R4172:Map2 UTSW 1 66413600 missense possibly damaging 0.89
R4198:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4200:Map2 UTSW 1 66425298 missense probably damaging 1.00
R4205:Map2 UTSW 1 66425290 missense probably damaging 1.00
R4700:Map2 UTSW 1 66410637 missense probably damaging 0.96
R4974:Map2 UTSW 1 66413505 missense probably benign 0.15
R5007:Map2 UTSW 1 66413289 missense possibly damaging 0.86
R5039:Map2 UTSW 1 66438796 missense probably damaging 1.00
R5237:Map2 UTSW 1 66439010 unclassified probably benign
R5313:Map2 UTSW 1 66425379 missense probably damaging 1.00
R5455:Map2 UTSW 1 66399391 missense probably damaging 1.00
R5490:Map2 UTSW 1 66413133 missense probably damaging 1.00
R5517:Map2 UTSW 1 66415256 missense probably benign 0.00
R5532:Map2 UTSW 1 66414620 missense probably damaging 1.00
R5583:Map2 UTSW 1 66416037 missense probably damaging 1.00
R5764:Map2 UTSW 1 66414875 missense probably damaging 0.99
R5996:Map2 UTSW 1 66414884 missense possibly damaging 0.67
R6058:Map2 UTSW 1 66415414 missense probably benign 0.05
R6199:Map2 UTSW 1 66425478 missense probably damaging 1.00
R6208:Map2 UTSW 1 66431590 missense probably damaging 1.00
R6276:Map2 UTSW 1 66399419 missense probably damaging 1.00
R6378:Map2 UTSW 1 66415329 missense probably damaging 1.00
R6424:Map2 UTSW 1 66414787 missense possibly damaging 0.67
R6743:Map2 UTSW 1 66415607 missense probably benign 0.04
R6837:Map2 UTSW 1 66414572 missense probably damaging 1.00
R6901:Map2 UTSW 1 66421773 missense possibly damaging 0.94
R6984:Map2 UTSW 1 66415236 missense possibly damaging 0.90
R6989:Map2 UTSW 1 66414906 missense probably benign 0.00
R7001:Map2 UTSW 1 66415487 missense probably benign 0.01
R7055:Map2 UTSW 1 66416824 missense probably damaging 1.00
R7094:Map2 UTSW 1 66412727 nonsense probably null
R7106:Map2 UTSW 1 66410744 missense possibly damaging 0.92
R7182:Map2 UTSW 1 66412653 missense possibly damaging 0.94
R7235:Map2 UTSW 1 66414648 missense probably damaging 1.00
R7424:Map2 UTSW 1 66414824 missense possibly damaging 0.69
R7473:Map2 UTSW 1 66415458 missense probably damaging 1.00
R7642:Map2 UTSW 1 66413307 missense probably benign 0.01
R7660:Map2 UTSW 1 66414377 missense probably damaging 1.00
R7673:Map2 UTSW 1 66413774 missense probably benign 0.03
R7768:Map2 UTSW 1 66414483 missense possibly damaging 0.94
R7796:Map2 UTSW 1 66416495 splice site probably null
R7834:Map2 UTSW 1 66416488 missense probably damaging 1.00
R7842:Map2 UTSW 1 66416411 missense probably benign
R7955:Map2 UTSW 1 66413716 missense probably damaging 1.00
R8056:Map2 UTSW 1 66415620 missense probably damaging 0.99
R8118:Map2 UTSW 1 66425391 missense probably damaging 1.00
R8135:Map2 UTSW 1 66413669 missense probably damaging 1.00
R8152:Map2 UTSW 1 66414743 missense probably benign 0.00
R8223:Map2 UTSW 1 66425490 missense probably damaging 1.00
R8329:Map2 UTSW 1 66415113 missense probably benign 0.01
R8344:Map2 UTSW 1 66421713 missense probably damaging 1.00
R8475:Map2 UTSW 1 66414005 missense probably damaging 1.00
R8548:Map2 UTSW 1 66413340 missense probably damaging 1.00
R8680:Map2 UTSW 1 66421713 missense probably damaging 1.00
R8713:Map2 UTSW 1 66414622 missense probably damaging 1.00
R8745:Map2 UTSW 1 66413397 missense probably benign 0.00
R8786:Map2 UTSW 1 66433596 critical splice donor site probably benign
R8790:Map2 UTSW 1 66438838 missense probably damaging 1.00
R8874:Map2 UTSW 1 66416364 missense probably damaging 1.00
R8887:Map2 UTSW 1 66415599 missense possibly damaging 0.48
R8948:Map2 UTSW 1 66380525 missense probably damaging 1.00
R8950:Map2 UTSW 1 66380525 missense probably damaging 1.00
V8831:Map2 UTSW 1 66415845 missense probably damaging 1.00
Z1177:Map2 UTSW 1 66380680 missense probably benign 0.01
Z1177:Map2 UTSW 1 66438361 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGATCAACTGCAATCACCC -3'
(R):5'- GGTGACCCATGACCCTGTAAAC -3'

Sequencing Primer
(F):5'- AGCTACTCTTCACGTACCCCAG -3'
(R):5'- CCATGACCCTGTAAACATCTCTG -3'
Posted On2015-10-08