Incidental Mutation 'R4613:Gli2'
ID 350928
Institutional Source Beutler Lab
Gene Symbol Gli2
Ensembl Gene ENSMUSG00000048402
Gene Name GLI-Kruppel family member GLI2
Synonyms
MMRRC Submission 041824-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4613 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 118834132-119053619 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118837511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 970 (V970A)
Ref Sequence ENSEMBL: ENSMUSP00000054837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062483]
AlphaFold Q0VGT2
Predicted Effect probably damaging
Transcript: ENSMUST00000062483
AA Change: V970A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000054837
Gene: ENSMUSG00000048402
AA Change: V970A

DomainStartEndE-ValueType
low complexity region 5 16 N/A INTRINSIC
low complexity region 36 43 N/A INTRINSIC
low complexity region 259 278 N/A INTRINSIC
ZnF_C2H2 417 442 4.98e-1 SMART
ZnF_C2H2 450 477 6.57e0 SMART
ZnF_C2H2 483 507 2.09e-3 SMART
ZnF_C2H2 513 538 4.17e-3 SMART
ZnF_C2H2 544 569 1.84e-4 SMART
low complexity region 637 657 N/A INTRINSIC
low complexity region 876 890 N/A INTRINSIC
low complexity region 930 945 N/A INTRINSIC
low complexity region 1035 1053 N/A INTRINSIC
low complexity region 1428 1435 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which belongs to the C2H2-type zinc finger protein subclass of the Gli family. Members of this subclass are characterized as transcription factors which bind DNA through zinc finger motifs. These motifs contain conserved H-C links. Gli family zinc finger proteins are mediators of Sonic hedgehog (Shh) signaling and they are implicated as potent oncogenes in the embryonal carcinoma cell. The protein encoded by this gene localizes to the cytoplasm and activates patched Drosophila homolog (PTCH) gene expression. It is also thought to play a role during embryogenesis. The encoded protein is associated with several phenotypes- Greig cephalopolysyndactyly syndrome, Pallister-Hall syndrome, preaxial polydactyly type IV, postaxial polydactyly types A1 and B. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skeletal malformations, absence of floorplate and foregut, lung and anorectal defects, and altered commissural neuron guidance. Most mutants die before embryonic day 18.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 83 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9830107B12Rik A T 17: 48,128,557 L130I probably benign Het
Abca9 A G 11: 110,144,784 V670A probably benign Het
Adad1 A G 3: 37,092,033 N517D probably damaging Het
Ankle2 T C 5: 110,231,379 L48P probably benign Het
Aoc3 A T 11: 101,337,659 probably benign Het
Areg A G 5: 91,143,504 K102R probably benign Het
Bmp1 T C 14: 70,508,523 T167A probably damaging Het
C4b C T 17: 34,734,551 G986D probably benign Het
Caml G T 13: 55,625,142 G200C probably damaging Het
Ccdc40 A C 11: 119,231,532 R53S probably benign Het
Cdh22 T A 2: 165,143,656 I337L probably benign Het
Col12a1 A T 9: 79,647,601 V2065D probably benign Het
Copg2 A G 6: 30,811,596 S591P probably benign Het
Cyp2d34 G A 15: 82,616,325 P438S probably damaging Het
Dchs1 T C 7: 105,772,724 D163G probably damaging Het
Depdc1b T C 13: 108,363,643 V230A probably damaging Het
Depdc5 T A 5: 32,975,446 L1300H probably damaging Het
Dnah10 G T 5: 124,762,869 probably null Het
Dsc2 A T 18: 20,041,819 D466E probably damaging Het
Dthd1 A G 5: 62,827,068 D372G probably damaging Het
Eogt G T 6: 97,134,304 Q199K probably benign Het
Epha6 C A 16: 59,666,597 R1029L possibly damaging Het
Eppin C A 2: 164,589,323 E128* probably null Het
Fam102b A T 3: 109,027,255 F23I probably benign Het
Fam160b1 C A 19: 57,371,187 P53Q probably damaging Het
Fgf20 T C 8: 40,286,611 R33G probably benign Het
Fgg A G 3: 83,010,090 N142S probably damaging Het
Gba C T 3: 89,208,644 probably null Het
Gramd1b A T 9: 40,307,993 V508D probably damaging Het
Gucy2c T A 6: 136,708,321 D898V probably damaging Het
Kcnj15 T C 16: 95,295,794 Y92H probably damaging Het
L3mbtl3 A T 10: 26,282,795 S652T unknown Het
Ldb2 G T 5: 44,476,551 Q326K probably benign Het
Lipi C A 16: 75,560,801 R292L probably benign Het
Lrrc36 G A 8: 105,449,614 V207I possibly damaging Het
Lyplal1 C T 1: 186,088,752 G166D probably benign Het
Map1b A T 13: 99,430,302 Y1970* probably null Het
Map2 A G 1: 66,425,469 N287D probably damaging Het
Map3k11 A T 19: 5,697,470 Q578L probably benign Het
Map3k11 G T 19: 5,697,471 Q578H probably damaging Het
Map4k4 G A 1: 40,017,191 S1012N probably benign Het
Mapk13 A T 17: 28,769,452 N15Y probably damaging Het
Mapk15 G A 15: 75,995,910 A125T probably damaging Het
Mrgprb1 C A 7: 48,447,708 R152L possibly damaging Het
Muc5ac T G 7: 141,791,103 Y104D possibly damaging Het
Myo1h A G 5: 114,348,379 N566S possibly damaging Het
Myo1h C A 5: 114,351,676 H647Q probably benign Het
Neo1 A G 9: 58,889,041 I1201T possibly damaging Het
Nlgn1 T C 3: 25,436,022 T514A probably benign Het
Olfr120 A G 17: 37,726,696 Y224C probably damaging Het
Olfr533 A T 7: 140,467,068 Y289F probably damaging Het
Olfr8 A G 10: 78,956,065 N287D probably damaging Het
Olfr985 T A 9: 40,127,722 K80* probably null Het
Orc2 A T 1: 58,500,309 L57* probably null Het
Otoa G A 7: 121,145,568 V850M probably damaging Het
Pcnx3 T C 19: 5,667,219 T1579A possibly damaging Het
Pde5a A T 3: 122,823,093 Y564F probably damaging Het
Pdxk A C 10: 78,447,919 I147S probably damaging Het
Pfdn5 A G 15: 102,328,752 D108G probably benign Het
Pink1 T C 4: 138,317,310 D342G probably damaging Het
Prkacb A T 3: 146,737,998 V336E probably damaging Het
Ptpro C A 6: 137,416,836 S13* probably null Het
Rfng A G 11: 120,782,650 L215P probably damaging Het
Rpn2 T C 2: 157,302,425 F336L possibly damaging Het
Sacs A G 14: 61,211,797 probably null Het
Sirpb1a T A 3: 15,417,037 Y77F probably benign Het
Skiv2l2 C A 13: 112,921,739 E53* probably null Het
Slc30a8 A G 15: 52,333,575 D294G probably benign Het
Sox13 T C 1: 133,388,934 I212V probably benign Het
Srebf2 T A 15: 82,185,348 I657N possibly damaging Het
Srsf6 C A 2: 162,933,709 T146K probably benign Het
Strn4 T C 7: 16,824,163 V162A possibly damaging Het
Sulf2 T C 2: 166,132,605 D53G probably damaging Het
Tbc1d8 T A 1: 39,372,708 I1016F probably damaging Het
Tfrc G T 16: 32,618,657 A278S probably damaging Het
Tnrc6a T G 7: 123,184,289 probably null Het
Vmn1r83 T C 7: 12,321,768 I121V probably benign Het
Vps13d T C 4: 145,131,655 S2200G possibly damaging Het
Washc2 T A 6: 116,229,269 D397E probably damaging Het
Wipf3 T C 6: 54,485,555 L250P probably damaging Het
Xirp1 A G 9: 120,019,682 F45S probably damaging Het
Xpo5 A G 17: 46,236,963 T910A probably benign Het
Zfp235 T C 7: 24,141,676 Y507H probably damaging Het
Other mutations in Gli2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Gli2 APN 1 118836891 missense probably benign
IGL01686:Gli2 APN 1 118848435 missense probably damaging 1.00
IGL01925:Gli2 APN 1 118853376 missense probably damaging 1.00
IGL02106:Gli2 APN 1 118836735 missense probably benign
IGL02202:Gli2 APN 1 118836866 missense probably damaging 0.96
IGL02255:Gli2 APN 1 118844349 critical splice donor site probably null
IGL02437:Gli2 APN 1 118836003 missense probably damaging 1.00
IGL02615:Gli2 APN 1 118844398 missense probably damaging 1.00
IGL02817:Gli2 APN 1 118836371 missense possibly damaging 0.55
IGL03294:Gli2 APN 1 118837436 missense probably benign
fairyfly UTSW 1 118840490 missense possibly damaging 0.93
flea UTSW 1 118835925 missense probably damaging 0.99
patu_digua UTSW 1 118837506 missense probably damaging 1.00
BB006:Gli2 UTSW 1 118842042 missense possibly damaging 0.88
BB016:Gli2 UTSW 1 118842042 missense possibly damaging 0.88
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0055:Gli2 UTSW 1 118890408 intron probably benign
R0164:Gli2 UTSW 1 118890283 intron probably benign
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0233:Gli2 UTSW 1 118835925 missense probably damaging 0.99
R0308:Gli2 UTSW 1 118842062 missense probably benign 0.00
R0418:Gli2 UTSW 1 118840490 missense possibly damaging 0.93
R0558:Gli2 UTSW 1 118837649 missense probably benign 0.01
R0600:Gli2 UTSW 1 118840389 missense probably damaging 1.00
R0630:Gli2 UTSW 1 118841918 missense possibly damaging 0.52
R0690:Gli2 UTSW 1 118844460 missense probably damaging 1.00
R0942:Gli2 UTSW 1 118837506 missense probably damaging 1.00
R1061:Gli2 UTSW 1 118854517 missense possibly damaging 0.71
R1104:Gli2 UTSW 1 118853350 missense probably damaging 1.00
R1141:Gli2 UTSW 1 118837937 missense possibly damaging 0.71
R1344:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1418:Gli2 UTSW 1 118841936 missense probably damaging 0.98
R1565:Gli2 UTSW 1 118841930 missense possibly damaging 0.57
R1605:Gli2 UTSW 1 118854560 missense probably damaging 1.00
R1640:Gli2 UTSW 1 118836524 missense possibly damaging 0.83
R1728:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1728:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1729:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1729:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1730:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1730:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1739:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1739:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1762:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1762:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1783:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1783:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1785:Gli2 UTSW 1 118868087 missense possibly damaging 0.68
R1785:Gli2 UTSW 1 119002044 missense probably benign 0.00
R1874:Gli2 UTSW 1 119002049 missense possibly damaging 0.83
R1969:Gli2 UTSW 1 118837700 missense probably benign 0.00
R2199:Gli2 UTSW 1 118837648 missense possibly damaging 0.95
R2377:Gli2 UTSW 1 118837125 missense possibly damaging 0.90
R2883:Gli2 UTSW 1 118868144 missense probably damaging 0.97
R2924:Gli2 UTSW 1 118836359 missense probably benign 0.00
R4363:Gli2 UTSW 1 118853370 missense probably benign 0.00
R4430:Gli2 UTSW 1 118837244 missense probably benign
R4463:Gli2 UTSW 1 118836008 missense probably damaging 1.00
R4583:Gli2 UTSW 1 118842068 missense probably benign
R4674:Gli2 UTSW 1 118836029 missense probably damaging 1.00
R4735:Gli2 UTSW 1 118840322 missense probably damaging 1.00
R4770:Gli2 UTSW 1 118982588 intron probably benign
R4936:Gli2 UTSW 1 118836140 missense probably benign
R5137:Gli2 UTSW 1 118855503 missense probably damaging 1.00
R5228:Gli2 UTSW 1 118836206 missense probably damaging 1.00
R5318:Gli2 UTSW 1 118844470 missense probably damaging 1.00
R5619:Gli2 UTSW 1 118836755 missense probably benign 0.27
R5661:Gli2 UTSW 1 118853302 nonsense probably null
R6005:Gli2 UTSW 1 118842064 missense probably damaging 1.00
R6012:Gli2 UTSW 1 118837715 missense probably damaging 0.99
R6341:Gli2 UTSW 1 118836224 missense probably damaging 1.00
R6357:Gli2 UTSW 1 118841959 missense probably damaging 1.00
R6425:Gli2 UTSW 1 118835894 nonsense probably null
R6513:Gli2 UTSW 1 118855554 missense probably damaging 1.00
R6802:Gli2 UTSW 1 118842065 missense probably damaging 1.00
R6889:Gli2 UTSW 1 118844416 missense probably damaging 1.00
R7259:Gli2 UTSW 1 118836534 missense probably benign
R7378:Gli2 UTSW 1 118848492 missense probably damaging 1.00
R7420:Gli2 UTSW 1 118835939 missense probably benign 0.00
R7489:Gli2 UTSW 1 118838175 missense probably benign 0.00
R7498:Gli2 UTSW 1 118835835 missense possibly damaging 0.89
R7929:Gli2 UTSW 1 118842042 missense possibly damaging 0.88
R8032:Gli2 UTSW 1 118836170 missense probably damaging 0.98
R8150:Gli2 UTSW 1 118835828 missense probably damaging 0.99
R8233:Gli2 UTSW 1 118844437 missense probably damaging 1.00
R8282:Gli2 UTSW 1 118837971 missense probably damaging 1.00
R8312:Gli2 UTSW 1 118868112 intron probably benign
R8686:Gli2 UTSW 1 118836687 missense probably benign
R8698:Gli2 UTSW 1 118842157 missense probably damaging 1.00
R8935:Gli2 UTSW 1 118836392 missense probably damaging 1.00
R8938:Gli2 UTSW 1 118836205 missense probably damaging 1.00
R8955:Gli2 UTSW 1 118855457 missense probably damaging 1.00
R9214:Gli2 UTSW 1 118868061 missense probably damaging 1.00
R9232:Gli2 UTSW 1 118836291 missense probably benign 0.00
R9295:Gli2 UTSW 1 118837266 missense probably damaging 1.00
R9369:Gli2 UTSW 1 118838155 missense probably benign 0.04
R9496:Gli2 UTSW 1 118836695 missense probably benign 0.00
X0028:Gli2 UTSW 1 118837277 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACCACATCATCTGGCAGC -3'
(R):5'- GATCGTGTAAGCCTTCGTACCC -3'

Sequencing Primer
(F):5'- AGGTCGCACTCTAGCCCTG -3'
(R):5'- TGAGCGTGCACTTCCTG -3'
Posted On 2015-10-08